e.g. 1:1246..9423
SNP Detail For snp_cf0020001694888    [See in GBrowse]
1.General Information
SNP ID: snp_cf0020001694888
Organism: Canis familiaris
Individual: FAMBTIM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CAGAGAGGAGGAGGGGGCACCACCCAGGCC
3'flank: GAACCAGGCCCTGCAGGGGCGCCGCCAGGC
3.Reference Map information
Chrom Position Reference FAMBTIM00001
Chr20 5549 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0078001745826 YJ9 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0006001975429 CRW C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0058002139453 LUPWRUS00003 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0010001684972 DQ2 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0007001469601 Dingo C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0074001725006 YJ5 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0071001742501 YJ2 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0049001721919 LJ4 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0064001718188 TM5 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0068001665337 TM9 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0066001742950 TM7 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0022001528659 FAMICHN00002 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0057002052040 LUPWRUS00002 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0017001726671 DQ9 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0008001705858 DQ10 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0009001709268 DQ1 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0039001410946 KM4 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0041001725169 KM6 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0042001786573 KM7 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0052001666819 LJ7 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0005002029593 CHW C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0029001230368 GS5 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0026001313210 GS2 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0060001678415 TM1 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0069001765742 YJ10 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0075001747532 YJ6 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0067001677810 TM8 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0065001689462 TM6 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0061001733003 TM2 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0063001682293 TM4 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0021001625742 FAMICHN00001 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0048001618348 LJ3 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0062001712590 TM3 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0073001702098 YJ4 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0056002161331 LUPWRUS00001 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0033001343404 GS9 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0047001654302 LJ2 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0011001733266 DQ3 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0036001341263 KM1 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0054001525421 LJ9 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0034002012387 ISW C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0040001516405 KM5 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0070001805967 YJ1 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0044001508191 KM9 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0045001537209 LJ10 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0014001678299 DQ6 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0076001760843 YJ7 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0037001444945 KM2 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0077001733774 YJ8 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0001000761799 solidGW1 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-08-01 2014-08-01
snp_cf0023001602677 FAMICHN00003 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0055002134622 LUPWCHN00001 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0013001628669 DQ5 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0035001656977 KM10 S CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0059001700566 TM10 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0053001658321 LJ8 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0072001754064 YJ3 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0012001693093 DQ4 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0016001711031 DQ8 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
snp_cf0043001436333 KM8 C CAGAGAGGAGGAGGGGGCACCACCCAGGCC GAACCAGGCCCTGCAGGGGCGCCGCCAGGC 2014-07-19 2014-07-19
6.Fasta Information
ACGGGACGTG GAGAGACCCC CAGAGAGGAG GAGGGGGCAC CACCCAGGCC
C
GAACCAGGCC CTGCAGGGGC GCCGCCAGGC ACACACAGCT GAACTCCCCA