e.g. 1:1246..9423
SNP Detail For snp_cf0020001694889    [See in GBrowse]
1.General Information
SNP ID: snp_cf0020001694889
Organism: Canis familiaris
Individual: FAMBTIM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: W
5'flank: GGGCTGGGACAGAGGGACAGCCGGGGAGCC
3'flank: CAGGTCACCAGGGTCTGTGCAAAGCGACCT
3.Reference Map information
Chrom Position Reference FAMBTIM00001
Chr20 5714 T W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0060001678416 TM1 A GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0062001712591 TM3 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0076001760844 YJ7 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0073001702099 YJ4 A GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0052001666821 LJ7 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0049001721920 LJ4 A GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0069001765743 YJ10 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0014001678300 DQ6 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0064001718189 TM5 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0010001684973 DQ2 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0068001665338 TM9 A GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0071001742503 YJ2 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0017001726672 DQ9 A GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0059001700567 TM10 A GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0065001689463 TM6 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0061001733004 TM2 A GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0072001754065 YJ3 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0016001711032 DQ8 A GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
snp_cf0013001628670 DQ5 W GGGCTGGGACAGAGGGACAGCCGGGGAGCC CAGGTCACCAGGGTCTGTGCAAAGCGACCT 2014-07-19 2014-07-19
6.Fasta Information
TGAGCCCCGC AGGCCAGGAA GGGCTGGGAC AGAGGGACAG CCGGGGAGCC
W
CAGGTCACCA GGGTCTGTGC AAAGCGACCT GGGAGGTCTT TGCTCCCTCT