e.g. 1:1246..9423
SNP Detail For snp_cf0022000000002    [See in GBrowse]
1.General Information
SNP ID: snp_cf0022000000002
Organism: Canis familiaris
Individual: FAMICHN00002
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GGGTGGCCCAGTCTCATAGAGGGCCCTCAG
3'flank: TTAGGCCACACCTGCTCATGGGTTCATGAC
3.Reference Map information
Chrom Position Reference FAMICHN00002
Chr1 17284 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0021000000005 FAMICHN00001 C GGGTGGCCCAGTCTCATAGAGGGCCCTCAG TTAGGCCACACCTGCTCATGGGTTCATGAC 2014-07-19 2014-07-19
snp_cf0056000000003 LUPWRUS00001 C GGGTGGCCCAGTCTCATAGAGGGCCCTCAG TTAGGCCACACCTGCTCATGGGTTCATGAC 2014-07-19 2014-07-19
snp_cf0057000000005 LUPWRUS00002 C GGGTGGCCCAGTCTCATAGAGGGCCCTCAG TTAGGCCACACCTGCTCATGGGTTCATGAC 2014-07-19 2014-07-19
snp_cf0020000000002 FAMBTIM00001 Y GGGTGGCCCAGTCTCATAGAGGGCCCTCAG TTAGGCCACACCTGCTCATGGGTTCATGAC 2014-07-19 2014-07-19
6.Fasta Information
TGATATCGAT GGGGATCCGG GGGTGGCCCA GTCTCATAGA GGGCCCTCAG
Y
TTAGGCCACA CCTGCTCATG GGTTCATGAC ATTTGGAGGG AGAAAAGAAG