e.g. 1:1246..9423
SNP Detail For snp_cf0022000000071    [See in GBrowse]
1.General Information
SNP ID: snp_cf0022000000071
Organism: Canis familiaris
Individual: FAMICHN00002
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CTGCTTCTGAAATCAGATTTATCATGGTAA
3'flank: GAAAATAGAAAAAGCACCCAACAATGTGCT
3.Reference Map information
Chrom Position Reference FAMICHN00002
Chr1 274445 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030108 4441 + A intron
ENSCAFG00000000001 47736 - A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073000000075 YJ4 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0042000000109 KM7 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0060000000062 TM1 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0064000000077 TM5 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0069000000060 YJ10 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0061000000072 TM2 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0036000000075 KM1 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0045000000071 LJ10 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0017000000061 DQ9 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0012000000069 DQ4 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0015000000082 DQ7 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0067000000065 TM8 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0014000000070 DQ6 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0007000000059 Dingo G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0037000000075 KM2 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0054000000059 LJ9 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0049000000077 LJ4 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0074000000080 YJ5 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0039000000085 KM4 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0043000000184 KM8 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0013000000063 DQ5 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0044000000079 KM9 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0038000000074 KM3 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0041000000092 KM6 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0027000000092 GS3 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0078000000082 YJ9 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0059000000067 TM10 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0010000000071 DQ2 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0020000000077 FAMBTIM00001 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0018000000169 FAMBBEM00001 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0063000000077 TM4 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0035000000085 KM10 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0040000000094 KM5 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0071000000067 YJ2 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0016000000072 DQ8 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0070000000061 YJ1 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0032000000088 GS8 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0009000000069 DQ1 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0053000000080 LJ8 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0025000000090 GS1 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0046000000070 LJ1 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0068000000058 TM9 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0075000000067 YJ6 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0004000000061 Basenji G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0019000000083 FAMBGSD00001 R CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0023000000070 FAMICHN00003 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0052000000069 LJ7 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
snp_cf0062000000058 TM3 G CTGCTTCTGAAATCAGATTTATCATGGTAA GAAAATAGAAAAAGCACCCAACAATGTGCT 2014-07-19 2014-07-19
6.Fasta Information
AGTGCTAAAA TTAATTTATA CTGCTTCTGA AATCAGATTT ATCATGGTAA
R
GAAAATAGAA AAAGCACCCA ACAATGTGCT CAAAGGAAAT CTAAAATTGT