e.g. 1:1246..9423
SNP Detail For snp_cf0022000000072    [See in GBrowse]
1.General Information
SNP ID: snp_cf0022000000072
Organism: Canis familiaris
Individual: FAMICHN00002
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: ACGCCTTGGGCTGAAGGCAGGTGCTAAACC
3'flank: CTGAGCCACCCAGTGATCCCTAAATTATAA
3.Reference Map information
Chrom Position Reference FAMICHN00002
Chr1 285472 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000001 36709 - G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0070000000062 YJ1 A ACGCCTTGGGCTGAAGGCAGGTGCTAAACC CTGAGCCACCCAGTGATCCCTAAATTATAA 2014-07-19 2014-07-19
snp_cf0073000000077 YJ4 R ACGCCTTGGGCTGAAGGCAGGTGCTAAACC CTGAGCCACCCAGTGATCCCTAAATTATAA 2014-07-19 2014-07-19
snp_cf0015000000085 DQ7 R ACGCCTTGGGCTGAAGGCAGGTGCTAAACC CTGAGCCACCCAGTGATCCCTAAATTATAA 2014-07-19 2014-07-19
snp_cf0067000000066 TM8 R ACGCCTTGGGCTGAAGGCAGGTGCTAAACC CTGAGCCACCCAGTGATCCCTAAATTATAA 2014-07-19 2014-07-19
snp_cf0054000000060 LJ9 R ACGCCTTGGGCTGAAGGCAGGTGCTAAACC CTGAGCCACCCAGTGATCCCTAAATTATAA 2014-07-19 2014-07-19
snp_cf0014000000071 DQ6 A ACGCCTTGGGCTGAAGGCAGGTGCTAAACC CTGAGCCACCCAGTGATCCCTAAATTATAA 2014-07-19 2014-07-19
snp_cf0069000000061 YJ10 A ACGCCTTGGGCTGAAGGCAGGTGCTAAACC CTGAGCCACCCAGTGATCCCTAAATTATAA 2014-07-19 2014-07-19
snp_cf0074000000082 YJ5 R ACGCCTTGGGCTGAAGGCAGGTGCTAAACC CTGAGCCACCCAGTGATCCCTAAATTATAA 2014-07-19 2014-07-19
snp_cf0007000000061 Dingo A ACGCCTTGGGCTGAAGGCAGGTGCTAAACC CTGAGCCACCCAGTGATCCCTAAATTATAA 2014-07-19 2014-07-19
6.Fasta Information
GATCCCAGGA CTCCAGGATC ACGCCTTGGG CTGAAGGCAG GTGCTAAACC
R
CTGAGCCACC CAGTGATCCC TAAATTATAA AAATTATGTA ATATTCTCAG