e.g. 1:1246..9423
SNP Detail For snp_cf0022000000075    [See in GBrowse]
1.General Information
SNP ID: snp_cf0022000000075
Organism: Canis familiaris
Individual: FAMICHN00002
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: AGGATGTCTGAAGGAAGAAGTGGAAGGCAG
3'flank: AAATGAATAAGCAGCCTACTTTAGCTAGAA
3.Reference Map information
Chrom Position Reference FAMICHN00002
Chr1 290889 C S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000001 31292 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0041000000096 KM6 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0037000000080 KM2 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0063000000080 TM4 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0012000000071 DQ4 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0060000000064 TM1 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0054000000064 LJ9 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0013000000065 DQ5 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0027000000095 GS3 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0069000000063 YJ10 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0018000000176 FAMBBEM00001 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0078000000085 YJ9 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0020000000080 FAMBTIM00001 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0074000000084 YJ5 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0009000000071 DQ1 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0052000000071 LJ7 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0059000000069 TM10 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0062000000060 TM3 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0064000000081 TM5 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0017000000063 DQ9 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0049000000080 LJ4 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0002000000153 CID1 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-08-02 2014-08-02
snp_cf0073000000080 YJ4 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0040000000097 KM5 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0071000000069 YJ2 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0016000000074 DQ8 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0044000000083 KM9 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0067000000068 TM8 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0015000000087 DQ7 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0042000000114 KM7 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0025000000093 GS1 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0035000000088 KM10 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0043000000191 KM8 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0045000000075 LJ10 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0075000000071 YJ6 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0010000000073 DQ2 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0014000000074 DQ6 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0070000000065 YJ1 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0036000000079 KM1 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0046000000073 LJ1 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0004000000063 Basenji G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0023000000072 FAMICHN00003 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0007000000063 Dingo G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0068000000060 TM9 G AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0039000000089 KM4 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0019000000086 FAMBGSD00001 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0032000000091 GS8 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
snp_cf0038000000078 KM3 S AGGATGTCTGAAGGAAGAAGTGGAAGGCAG AAATGAATAAGCAGCCTACTTTAGCTAGAA 2014-07-19 2014-07-19
6.Fasta Information
CTAGGAGGAA GGCCAGCATT AGGATGTCTG AAGGAAGAAG TGGAAGGCAG
S
AAATGAATAA GCAGCCTACT TTAGCTAGAA CAAAGAATAT GCAAAGGGGA