e.g. 1:1246..9423
SNP Detail For snp_cf0023000871128    [See in GBrowse]
1.General Information
SNP ID: snp_cf0023000871128
Organism: Canis familiaris
Individual: FAMICHN00003
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22402767  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CCTGGTCAAGTGCTTCCAGGACCCCGAATA
3'flank: GAGTCCATCCTTGTCACAGCACAGGAGGGG
3.Reference Map information
Chrom Position Reference FAMICHN00003
Chr15 337308 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002491 1807 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000003927 120 TAT => TAC ENSCAFP00000003629 40 Y => Y
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0059000929572 TM10 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0034001081655 ISW C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0027000719137 GS3 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0017000935147 DQ9 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0029000663035 GS5 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0064000928109 TM5 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0009000923857 DQ1 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0033000720839 GS9 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0057001112790 LUPWRUS00002 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0024000748267 GS10 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0004000758362 Basenji C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0045000826390 LJ10 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0058001147215 LUPWRUS00003 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0078000938429 YJ9 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0046000849392 LJ1 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0074000935080 YJ5 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0025000710483 GS1 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0068000881276 TM9 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0032000709661 GS8 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0076000945455 YJ7 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0050000851443 LJ5 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0062000922685 TM3 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0021000879041 FAMICHN00001 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0035000894561 KM10 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0036000740333 KM1 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0020000911436 FAMBTIM00001 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0028000687043 GS4 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0052000896894 LJ7 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0011000927581 DQ3 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0002000599649 CID1 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-08-02 2014-08-02
snp_cf0001000388326 solidGW1 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-08-01 2014-08-01
snp_cf0039000730505 KM4 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0069000950520 YJ10 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0018000764760 FAMBBEM00001 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0026000711542 GS2 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0019000720326 FAMBGSD00001 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0067000883966 TM8 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0061000932308 TM2 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0041000901735 KM6 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0031000737986 GS7 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0043000762220 KM8 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0071000939947 YJ2 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0072000941519 YJ3 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0053000895584 LJ8 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0016000916961 DQ8 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0014000907403 DQ6 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0015000920052 DQ7 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0038000725157 KM3 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0044000817910 KM9 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0022000816231 FAMICHN00002 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0077000937347 YJ8 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0048000876977 LJ3 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0005001130536 CHW C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0003000506028 dbSNP139 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0051000920856 LJ6 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0042000933459 KM7 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0040000820840 KM5 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0060000924678 TM1 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0030000740112 GS6 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0008000906075 DQ10 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0070000967594 YJ1 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0055001152643 LUPWCHN00001 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0066000937785 TM7 C CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
snp_cf0012000922807 DQ4 Y CCTGGTCAAGTGCTTCCAGGACCCCGAATA GAGTCCATCCTTGTCACAGCACAGGAGGGG 2014-07-19 2014-07-19
6.Fasta Information
TGCCTTGGCT ACTTTGAGGA CCTGGTCAAG TGCTTCCAGG ACCCCGAATA
Y
GAGTCCATCC TTGTCACAGC ACAGGAGGGG CTCCACACCT CCCCGCTGAC