e.g. 1:1246..9423
SNP Detail For snp_cf0023000871307    [See in GBrowse]
1.General Information
SNP ID: snp_cf0023000871307
Organism: Canis familiaris
Individual: FAMICHN00003
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: TTCTCTTGCTGCAACCCAGAAAGCTTTTCT
3'flank: ACAATTCTTGGTTGCTCTTAAGATGCTGAA
3.Reference Map information
Chrom Position Reference FAMICHN00003
Chr15 715155 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002549 42028 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000004024 1268 TCA => TTA ENSCAFP00000003718 423 S => L
- ENSCAFT00000004023 1379 TCA => TTA ENSCAFP00000003717 460 S => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0069000951063 YJ10 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0050000851898 LJ5 A TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0058001147736 LUPWRUS00003 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0071000940449 YJ2 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0065000900768 TM6 A TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0076000946036 YJ7 A TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0077000937894 YJ8 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0002000599936 CID1 A TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-08-02 2014-08-02
snp_cf0072000942034 YJ3 A TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0045000826849 LJ10 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0046000849864 LJ1 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0061000932893 TM2 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0017000935708 DQ9 A TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0074000935588 YJ5 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0007000776395 Dingo R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0049000925748 LJ4 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0054000827104 LJ9 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0047000885404 LJ2 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0070000968124 YJ1 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0021000879574 FAMICHN00001 A TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0051000921371 LJ6 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
snp_cf0008000906255 DQ10 R TTCTCTTGCTGCAACCCAGAAAGCTTTTCT ACAATTCTTGGTTGCTCTTAAGATGCTGAA 2014-07-19 2014-07-19
6.Fasta Information
ATTTTTCACG TAGCACTTCC TTCTCTTGCT GCAACCCAGA AAGCTTTTCT
A
ACAATTCTTG GTTGCTCTTA AGATGCTGAA AAACAATTTT TAAAAAATTA