e.g. 1:1246..9423
SNP Detail For snp_cf0023000000006    [See in GBrowse]
1.General Information
SNP ID: snp_cf0023000000006
Organism: Canis familiaris
Individual: FAMICHN00003
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AAACTAAGCTAAAAACAAAAAACAAAAAAC
3'flank: AAAAACAAAACTAAGCTAAAACCCACCTCG
3.Reference Map information
Chrom Position Reference FAMICHN00003
Chr1 13522 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0021000000004 FAMICHN00001 A AAACTAAGCTAAAAACAAAAAACAAAAAAC AAAAACAAAACTAAGCTAAAACCCACCTCG 2014-07-19 2014-07-19
snp_cf0056000000002 LUPWRUS00001 A AAACTAAGCTAAAAACAAAAAACAAAAAAC AAAAACAAAACTAAGCTAAAACCCACCTCG 2014-07-19 2014-07-19
snp_cf0057000000004 LUPWRUS00002 R AAACTAAGCTAAAAACAAAAAACAAAAAAC AAAAACAAAACTAAGCTAAAACCCACCTCG 2014-07-19 2014-07-19
snp_cf0001000000019 solidGW1 R AAACTAAGCTAAAAACAAAAAACAAAAAAC AAAAACAAAACTAAGCTAAAACCCACCTCG 2014-08-01 2014-08-01
6.Fasta Information
GTACCTGAGA CCAGCCCTTA AAACTAAGCT AAAAACAAAA AACAAAAAAC
R
AAAAACAAAA CTAAGCTAAA ACCCACCTCG GGGTATAAGT CTCTGCTCTG