e.g. 1:1246..9423
SNP Detail For snp_cf0024000649910    [See in GBrowse]
1.General Information
SNP ID: snp_cf0024000649910
Organism: Canis familiaris
Individual: GS10
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22357441  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: ACTCTGGGCCCTGGGTGTGTGCAGGGACAA
3'flank: GTGAGCCGGAGGGACAGGGTCCCCAAGTGC
3.Reference Map information
Chrom Position Reference GS10
Chr14 639052 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029790 3816 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000047285 1113 AAT => AAC ENSCAFP00000038371 371 N => N
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0021000761831 FAMICHN00001 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0071000817732 YJ2 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0040000705936 KM5 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0069000824165 YJ10 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0070000841633 YJ1 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0060000804515 TM1 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0006000920268 CRW C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0036000635497 KM1 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0032000614384 GS8 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0077000818197 YJ8 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0066000815406 TM7 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0043000656638 KM8 Y ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0009000802710 DQ1 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0001000349861 solidGW1 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-08-01 2014-08-01
snp_cf0049000806075 LJ4 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0013000773624 DQ5 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0055001004207 LUPWCHN00001 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0076000821430 YJ7 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0072000824099 YJ3 Y ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0029000562820 GS5 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0074000811822 YJ5 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0057000983519 LUPWRUS00002 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0041000778087 KM6 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0020000792652 FAMBTIM00001 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0030000644039 GS6 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0003000440301 dbSNP139 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0064000809459 TM5 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0059000811893 TM10 Y ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0052000777262 LJ7 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0038000633378 KM3 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0010000800547 DQ2 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0033000619288 GS9 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0053000777549 LJ8 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0073000814218 YJ4 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0014000788680 DQ6 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0051000800817 LJ6 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0078000816081 YJ9 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0011000807326 DQ3 Y ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0035000778111 KM10 Y ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0019000620997 FAMBGSD00001 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0068000770427 TM9 Y ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0042000805198 KM7 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0007000673406 Dingo C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0023000755282 FAMICHN00003 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0063000791093 TM4 Y ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0017000815395 DQ9 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0058001004944 LUPWRUS00003 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0037000660295 KM2 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0008000785847 DQ10 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0002000524239 CID1 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-08-02 2014-08-02
snp_cf0016000795916 DQ8 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0039000620466 KM4 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0067000778323 TM8 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0061000811874 TM2 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0012000803405 DQ4 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0025000604097 GS1 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0056001015602 LUPWRUS00001 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0048000760663 LJ3 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0026000611149 GS2 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0028000594090 GS4 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0005000991513 CHW C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0015000803077 DQ7 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0027000621265 GS3 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0034000944609 ISW C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0031000640029 GS7 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0065000780415 TM6 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0047000767656 LJ2 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0075000825816 YJ6 C ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0062000804369 TM3 Y ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
snp_cf0044000713016 KM9 Y ACTCTGGGCCCTGGGTGTGTGCAGGGACAA GTGAGCCGGAGGGACAGGGTCCCCAAGTGC 2014-07-19 2014-07-19
6.Fasta Information
ATGAACCTCA CTGGCGATGC ACTCTGGGCC CTGGGTGTGT GCAGGGACAA
C
GTGAGCCGGA GGGACAGGGT CCCCAAGTGC CCTGAGAATG GGTTCTGGGT