e.g. 1:1246..9423
SNP Detail For snp_cf0024000649928    [See in GBrowse]
1.General Information
SNP ID: snp_cf0024000649928
Organism: Canis familiaris
Individual: GS10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GGGGGGCGACCATTTGCGCTTCCTGCTGCC
3'flank: GTGGCCTCTCTGAGCAGGGTCTCCATGTCC
3.Reference Map information
Chrom Position Reference GS10
Chr14 668951 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 110435 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000050108 22002 ACA => ACG ENSCAFP00000035951 7334 T => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062000804388 TM3 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0059000811919 TM10 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0019000621025 FAMBGSD00001 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0025000604126 GS1 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0022000711507 FAMICHN00002 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0057000983542 LUPWRUS00002 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0007000673430 Dingo C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0058001004963 LUPWRUS00003 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0027000621296 GS3 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0078000816108 YJ9 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0072000824117 YJ3 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0075000825848 YJ6 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0016000795937 DQ8 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0033000619319 GS9 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0028000594106 GS4 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0063000791109 TM4 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0037000660318 KM2 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0068000770452 TM9 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0026000611168 GS2 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0061000811899 TM2 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0070000841663 YJ1 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0034000944627 ISW C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0041000778113 KM6 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0031000640049 GS7 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0047000767677 LJ2 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0064000809483 TM5 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0001000349877 solidGW1 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-08-01 2014-08-01
snp_cf0069000824186 YJ10 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0030000644067 GS6 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0021000761858 FAMICHN00001 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0006000920288 CRW C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0053000777574 LJ8 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0052000777293 LJ7 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0071000817760 YJ2 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0042000805228 KM7 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0038000633400 KM3 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0043000656658 KM8 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0023000755305 FAMICHN00003 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0029000562848 GS5 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0073000814242 YJ4 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0040000705966 KM5 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0051000800844 LJ6 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0036000635523 KM1 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0049000806102 LJ4 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0032000614405 GS8 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0017000815424 DQ9 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0055001004232 LUPWCHN00001 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0008000785878 DQ10 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0039000620495 KM4 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0077000818225 YJ8 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0014000788709 DQ6 Y GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
snp_cf0076000821461 YJ7 C GGGGGGCGACCATTTGCGCTTCCTGCTGCC GTGGCCTCTCTGAGCAGGGTCTCCATGTCC 2014-07-19 2014-07-19
6.Fasta Information
AGATGGAAGA GGTCACGGGC GGGGGGCGAC CATTTGCGCT TCCTGCTGCC
C
GTGGCCTCTC TGAGCAGGGT CTCCATGTCC TCTGGCTCCT CAGTGATGTG