e.g. 1:1246..9423
SNP Detail For snp_cf0024000649945    [See in GBrowse]
1.General Information
SNP ID: snp_cf0024000649945
Organism: Canis familiaris
Individual: GS10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: ATCCCTGCGGGGCTTACAGACCAGCAGGTG
3'flank: TGGCGGAACAGGAAGACGTGCCGGTGGTGG
3.Reference Map information
Chrom Position Reference GS10
Chr14 690418 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 88968 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 16173 CAT => CAC ENSCAFP00000001649 5391 H => H
- ENSCAFT00000050108 17763 CAT => CAC ENSCAFP00000035951 5921 H => H
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0069000824204 YJ10 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0020000792684 FAMBTIM00001 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0074000811854 YJ5 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0036000635535 KM1 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0025000604144 GS1 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0032000614422 GS8 G ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0019000621043 FAMBGSD00001 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0017000815433 DQ9 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0044000713040 KM9 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0055001004244 LUPWCHN00001 G ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0028000594123 GS4 G ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0033000619337 GS9 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0076000821474 YJ7 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0072000824135 YJ3 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0075000825866 YJ6 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0041000778127 KM6 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0026000611184 GS2 G ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0070000841681 YJ1 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0039000620507 KM4 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0064000809495 TM5 G ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0057000983557 LUPWRUS00002 G ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0061000811915 TM2 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0042000805243 KM7 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0027000621316 GS3 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0037000660336 KM2 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0040000705986 KM5 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0005000991540 CHW R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0031000640065 GS7 G ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0030000644086 GS6 G ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0001000349890 solidGW1 G ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-08-01 2014-08-01
snp_cf0077000818244 YJ8 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0063000791122 TM4 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
snp_cf0062000804403 TM3 R ATCCCTGCGGGGCTTACAGACCAGCAGGTG TGGCGGAACAGGAAGACGTGCCGGTGGTGG 2014-07-19 2014-07-19
6.Fasta Information
CTGAAAGTGT CGGTGCGGGA ATCCCTGCGG GGCTTACAGA CCAGCAGGTG
G
TGGCGGAACA GGAAGACGTG CCGGTGGTGG CCCTTCCAGG GCATCCGTGC