e.g. 1:1246..9423
SNP Detail For snp_cf0024000649947    [See in GBrowse]
1.General Information
SNP ID: snp_cf0024000649947
Organism: Canis familiaris
Individual: GS10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC
3'flank: GCCGACAGCACCTCTTCTGTGTATTTCTGT
3.Reference Map information
Chrom Position Reference GS10
Chr14 690919 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 88467 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 15834 GCT => GCC ENSCAFP00000001649 5278 A => A
- ENSCAFT00000050108 17424 GCT => GCC ENSCAFP00000035951 5808 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0069000824206 YJ10 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0074000811856 YJ5 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0025000604146 GS1 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0060000804534 TM1 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0030000644088 GS6 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0019000621045 FAMBGSD00001 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0006000920300 CRW G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0017000815434 DQ9 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0055001004245 LUPWCHN00001 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0044000713041 KM9 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0075000825868 YJ6 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0072000824137 YJ3 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0076000821475 YJ7 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0043000656675 KM8 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0041000778128 KM6 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0033000619339 GS9 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0028000594125 GS4 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0039000620508 KM4 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0064000809496 TM5 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0052000777298 LJ7 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0040000705988 KM5 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0056001015621 LUPWRUS00001 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0057000983558 LUPWRUS00002 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0071000817769 YJ2 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0026000611186 GS2 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0061000811917 TM2 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0005000991541 CHW R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0042000805244 KM7 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0027000621318 GS3 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0037000660338 KM2 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0001000349891 solidGW1 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-08-01 2014-08-01
snp_cf0078000816114 YJ9 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0032000614424 GS8 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0058001004978 LUPWRUS00003 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0031000640067 GS7 G GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0036000635536 KM1 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0062000804405 TM3 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0063000791124 TM4 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
snp_cf0077000818246 YJ8 R GGGTGGTGGGGGCGGCTGCGAGGGGTCTGC GCCGACAGCACCTCTTCTGTGTATTTCTGT 2014-07-19 2014-07-19
6.Fasta Information
TGTTCCAGAA AGTGCTGCAG GGGTGGTGGG GGCGGCTGCG AGGGGTCTGC
G
GCCGACAGCA CCTCTTCTGT GTATTTCTGT GAGAACCGCA GGCCGGGGTT