e.g. 1:1246..9423
SNP Detail For snp_cf0024000649959    [See in GBrowse]
1.General Information
SNP ID: snp_cf0024000649959
Organism: Canis familiaris
Individual: GS10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: CACATCCCCCGCCAGGAAGGTCACCCGGCA
3'flank: CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA
3.Reference Map information
Chrom Position Reference GS10
Chr14 706688 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 72698 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 11502 AGC => AGT ENSCAFP00000001649 3834 S => S
- ENSCAFT00000050108 13182 AGC => AGT ENSCAFP00000035951 4394 S => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0041000778151 KM6 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0062000804421 TM3 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0035000778135 KM10 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0074000811872 YJ5 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0061000811940 TM2 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0028000594137 GS4 A CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0029000562879 GS5 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0036000635554 KM1 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0070000841698 YJ1 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0031000640083 GS7 A CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0020000792702 FAMBTIM00001 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0032000614440 GS8 A CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0025000604160 GS1 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0027000621336 GS3 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0017000815451 DQ9 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0033000619357 GS9 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0076000821494 YJ7 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0019000621059 FAMBGSD00001 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0001000349907 solidGW1 A CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-08-01 2014-08-01
snp_cf0039000620526 KM4 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0075000825885 YJ6 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0072000824151 YJ3 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0043000656691 KM8 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0042000805268 KM7 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0026000611202 GS2 A CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0069000824230 YJ10 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0055001004263 LUPWCHN00001 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0034000944652 ISW A CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0030000644111 GS6 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0040000706005 KM5 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0058001004996 LUPWRUS00003 A CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0063000791140 TM4 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0005000991557 CHW R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0037000660362 KM2 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0077000818264 YJ8 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0044000713057 KM9 R CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
snp_cf0050000736478 LJ5 A CACATCCCCCGCCAGGAAGGTCACCCGGCA CTGTCCTGCGGCCGCAGGTTTTTGAGCAGA 2014-07-19 2014-07-19
6.Fasta Information
GTGAGGAATG CGGAAGTCAC CACATCCCCC GCCAGGAAGG TCACCCGGCA
A
CTGTCCTGCG GCCGCAGGTT TTTGAGCAGA AGCAGATGCC GAAGACCGTT