e.g. 1:1246..9423
SNP Detail For snp_cf0024000649971    [See in GBrowse]
1.General Information
SNP ID: snp_cf0024000649971
Organism: Canis familiaris
Individual: GS10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GGGCCGCAGGTCCCGCACCACCAGCTCCAG
3'flank: ACTGGGCCGTCCTGCCGCATGCTGTACTTG
3.Reference Map information
Chrom Position Reference GS10
Chr14 720988 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 58398 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 9045 GTG => GTA ENSCAFP00000001649 3015 V => V
- ENSCAFT00000050108 9726 GTG => GTA ENSCAFP00000035951 3242 V => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0026000611218 GS2 Y GGGCCGCAGGTCCCGCACCACCAGCTCCAG ACTGGGCCGTCCTGCCGCATGCTGTACTTG 2014-07-19 2014-07-19
snp_cf0031000640100 GS7 Y GGGCCGCAGGTCCCGCACCACCAGCTCCAG ACTGGGCCGTCCTGCCGCATGCTGTACTTG 2014-07-19 2014-07-19
snp_cf0028000594149 GS4 T GGGCCGCAGGTCCCGCACCACCAGCTCCAG ACTGGGCCGTCCTGCCGCATGCTGTACTTG 2014-07-19 2014-07-19
snp_cf0019000621073 FAMBGSD00001 Y GGGCCGCAGGTCCCGCACCACCAGCTCCAG ACTGGGCCGTCCTGCCGCATGCTGTACTTG 2014-07-19 2014-07-19
snp_cf0025000604174 GS1 Y GGGCCGCAGGTCCCGCACCACCAGCTCCAG ACTGGGCCGTCCTGCCGCATGCTGTACTTG 2014-07-19 2014-07-19
snp_cf0003000440333 dbSNP139 T GGGCCGCAGGTCCCGCACCACCAGCTCCAG ACTGGGCCGTCCTGCCGCATGCTGTACTTG 2014-07-19 2014-07-19
snp_cf0029000562892 GS5 T GGGCCGCAGGTCCCGCACCACCAGCTCCAG ACTGGGCCGTCCTGCCGCATGCTGTACTTG 2014-07-19 2014-07-19
6.Fasta Information
GAGTACTGCC CACTGTCCTG GGGCCGCAGG TCCCGCACCA CCAGCTCCAG
T
ACTGGGCCGT CCTGCCGCAT GCTGTACTTG CCTCCGGGCC GCAGAACTTC