e.g. 1:1246..9423
SNP Detail For snp_cf0024000649979    [See in GBrowse]
1.General Information
SNP ID: snp_cf0024000649979
Organism: Canis familiaris
Individual: GS10
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22321358  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CCACCGCCGCGTACCGCTGACCGTGAGCTG
3'flank: GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG
3.Reference Map information
Chrom Position Reference GS10
Chr14 731521 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 47865 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 4836 GCA => GCG ENSCAFP00000001649 1612 A => A
- ENSCAFT00000050108 5670 GCA => GCG ENSCAFP00000035951 1890 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0013000773670 DQ5 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0062000804442 TM3 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0042000805290 KM7 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0028000594157 GS4 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0041000778174 KM6 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0032000614463 GS8 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0066000815454 TM7 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0037000660386 KM2 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0058001005021 LUPWRUS00003 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0061000811968 TM2 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0057000983588 LUPWRUS00002 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0036000635574 KM1 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0052000777326 LJ7 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0025000604182 GS1 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0043000656715 KM8 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0015000803123 DQ7 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0026000611228 GS2 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0019000621081 FAMBGSD00001 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0075000825907 YJ6 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0031000640111 GS7 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0018000669871 FAMBBEM00001 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0067000778369 TM8 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0078000816145 YJ9 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0072000824175 YJ3 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0076000821510 YJ7 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0039000620546 KM4 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0069000824257 YJ10 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0035000778145 KM10 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0056001015649 LUPWRUS00001 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0029000562900 GS5 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0010000800593 DQ2 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0030000644138 GS6 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0055001004285 LUPWCHN00001 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0060000804564 TM1 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0003000440346 dbSNP139 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0040000706026 KM5 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0033000619381 GS9 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0077000818285 YJ8 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0063000791161 TM4 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0064000809529 TM5 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0005000991577 CHW C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0008000785913 DQ10 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0012000803456 DQ4 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0044000713077 KM9 C CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
snp_cf0027000621360 GS3 Y CCACCGCCGCGTACCGCTGACCGTGAGCTG GCGCTGGTGCGGTCGTCGCGGGTTTCGCAG 2014-07-19 2014-07-19
6.Fasta Information
CCCACCACCC ACCGCGCACC CCACCGCCGC GTACCGCTGA CCGTGAGCTG
C
GCGCTGGTGC GGTCGTCGCG GGTTTCGCAG GCGTACTCCC CTGCATCCTC