e.g. 1:1246..9423
SNP Detail For snp_cf0025002881718    [See in GBrowse]
1.General Information
SNP ID: snp_cf0025002881718
Organism: Canis familiaris
Individual: GS1
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24022611  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: W
5'flank: TTTGCCCATTCTTACACTCAGCAGAGAACG
3'flank: ATCTGACCAAGAGATGCCAGCAGGTTGATG
3.Reference Map information
Chrom Position Reference GS1
Chr4 2566323 T W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010034 533375 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044598 6360 ATA => ATT ENSCAFP00000040266 2120 I => I
- ENSCAFT00000015962 6333 ATA => ATT ENSCAFP00000014764 2111 I => I
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0043003106341 KM8 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0065003678118 TM6 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0012003692689 DQ4 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0051003691788 LJ6 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0073003716386 YJ4 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0021003540231 FAMICHN00001 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0022003294056 FAMICHN00002 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0008003744003 DQ10 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0062003696542 TM3 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0010003708379 DQ2 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0013003622271 DQ5 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0029002729470 GS5 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0031002932310 GS7 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0046003442571 LJ1 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0071003781416 YJ2 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0028002800688 GS4 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0054003382975 LJ9 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0035003582573 KM10 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0036002932395 KM1 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0069003813550 YJ10 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0007003135308 Dingo A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0026002899814 GS2 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0059003696550 TM10 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0034004268447 ISW A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0015003683122 DQ7 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0070003915336 YJ1 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0011003752210 DQ3 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0052003629646 LJ7 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0027002896733 GS3 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0001001610878 solidGW1 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-08-01 2014-08-01
snp_cf0048003517242 LJ3 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0020003661539 FAMBTIM00001 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0064003725068 TM5 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0014003662984 DQ6 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0045003369783 LJ10 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0004003088487 Basenji A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0016003697358 DQ8 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0018003068390 FAMBBEM00001 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0050003434398 LJ5 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0066003786547 TM7 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0030002881394 GS6 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0005004407488 CHW W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0049003715956 LJ4 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0067003642208 TM8 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0077003765740 YJ8 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0002002454119 CID1 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-08-02 2014-08-02
snp_cf0055004562306 LUPWCHN00001 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0042003854041 KM7 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0017003744664 DQ9 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0072003792173 YJ3 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0032002858266 GS8 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0063003638644 TM4 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0033002911275 GS9 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0024002913570 GS10 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0039003107918 KM4 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0040003208026 KM5 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0009003682894 DQ1 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0044003257180 KM9 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0003002123216 dbSNP139 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0037003083804 KM2 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0060003609662 TM1 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0076003806051 YJ7 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0061003747874 TM2 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0075003784160 YJ6 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0074003721592 YJ5 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0038002975215 KM3 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0053003608760 LJ8 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0056004584718 LUPWRUS00001 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0019002874218 FAMBGSD00001 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0068003655130 TM9 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0041003697862 KM6 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0047003592289 LJ2 W TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0078003776334 YJ9 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
snp_cf0023003526074 FAMICHN00003 A TTTGCCCATTCTTACACTCAGCAGAGAACG ATCTGACCAAGAGATGCCAGCAGGTTGATG 2014-07-19 2014-07-19
6.Fasta Information
ATCATAAGCT TCTCTTCTTC TTTGCCCATT CTTACACTCA GCAGAGAACG
W
ATCTGACCAA GAGATGCCAG CAGGTTGATG GTATCCTCCA CGGAGACACC