e.g. 1:1246..9423
SNP Detail For snp_cf0025002881754    [See in GBrowse]
1.General Information
SNP ID: snp_cf0025002881754
Organism: Canis familiaris
Individual: GS1
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24022649  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AAACAAGAACTCAGTTGTCCCCCCAACTGG
3'flank: TCCCGGGCGTGAAGGCTGCCCTCTTTCACA
3.Reference Map information
Chrom Position Reference GS1
Chr4 2589258 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010034 510440 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044598 5406 GAT => GAC ENSCAFP00000040266 1802 D => D
- ENSCAFT00000015962 5379 GAT => GAC ENSCAFP00000014764 1793 D => D
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0074003721627 YJ5 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0012003692724 DQ4 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0008003744040 DQ10 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0019002874233 FAMBGSD00001 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0049003715979 LJ4 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0002002454136 CID1 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-08-02 2014-08-02
snp_cf0030002881429 GS6 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0053003608800 LJ8 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0016003697394 DQ8 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0075003784181 YJ6 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0073003716410 YJ4 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0046003442611 LJ1 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0015003683164 DQ7 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0032002858283 GS8 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0013003622308 DQ5 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0003002123232 dbSNP139 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0026002899850 GS2 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0076003806077 YJ7 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0070003915375 YJ1 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0028002800726 GS4 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0051003691815 LJ6 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0042003854066 KM7 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0038002975231 KM3 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0045003369822 LJ10 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0024002913586 GS10 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0037003083820 KM2 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0031002932326 GS7 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0041003697884 KM6 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0027002896749 GS3 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0055004562340 LUPWCHN00001 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0021003540255 FAMICHN00001 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0077003765781 YJ8 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0078003776370 YJ9 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0011003752247 DQ3 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0022003294077 FAMICHN00002 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0065003678134 TM6 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0062003696566 TM3 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0044003257215 KM9 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0067003642250 TM8 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0039003107954 KM4 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0035003582594 KM10 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0033002911311 GS9 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0069003813574 YJ10 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0036002932411 KM1 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0050003434417 LJ5 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0040003208062 KM5 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0043003106358 KM8 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0007003135340 Dingo R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0018003068406 FAMBBEM00001 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0048003517263 LJ3 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0010003708403 DQ2 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0009003682929 DQ1 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0063003638659 TM4 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0060003609697 TM1 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0047003592329 LJ2 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0061003747917 TM2 R AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0052003629672 LJ7 G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
snp_cf0004003088505 Basenji G AAACAAGAACTCAGTTGTCCCCCCAACTGG TCCCGGGCGTGAAGGCTGCCCTCTTTCACA 2014-07-19 2014-07-19
6.Fasta Information
AAAAGCTTGA TGAGAGGTAC AAACAAGAAC TCAGTTGTCC CCCCAACTGG
R
TCCCGGGCGT GAAGGCTGCC CTCTTTCACA GCTTCTGTCA GCATCTGAAT