e.g. 1:1246..9423
SNP Detail For snp_cf0026000000060    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026000000060
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs21882969  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: ACTGATCATGAAAAAGAAATTAACTTTGAT
3'flank: CACTTTAGTGAAGAGACATAATAATTTAGA
3.Reference Map information
Chrom Position Reference GS2
Chr1 273487 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030108 3483 + A intron
ENSCAFG00000000001 48694 - A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073000000074 YJ4 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0042000000107 KM7 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0057000000067 LUPWRUS00002 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0029000000059 GS5 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0060000000061 TM1 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0058000000078 LUPWRUS00003 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0006000000070 CRW G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0064000000075 TM5 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0045000000069 LJ10 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0061000000071 TM2 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0036000000074 KM1 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0069000000059 YJ10 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0007000000058 Dingo G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0012000000068 DQ4 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0017000000060 DQ9 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0003000000164 dbSNP139 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0048000000071 LJ3 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0054000000058 LJ9 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0066000000073 TM7 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0067000000064 TM8 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0024000000061 GS10 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0033000000080 GS9 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0074000000078 YJ5 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0005000000053 CHW G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0037000000074 KM2 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0059000000066 TM10 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0015000000080 DQ7 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0056000000159 LUPWRUS00001 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0039000000083 KM4 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0014000000069 DQ6 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0049000000076 LJ4 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0043000000183 KM8 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0050000000077 LJ5 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0065000000177 TM6 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0034000000165 ISW R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0013000000062 DQ5 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0038000000073 KM3 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0044000000077 KM9 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0041000000090 KM6 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0031000000062 GS7 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0072000000063 YJ3 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0027000000091 GS3 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0078000000080 YJ9 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0055000000058 LUPWCHN00001 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0020000000075 FAMBTIM00001 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0010000000070 DQ2 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0040000000093 KM5 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0071000000066 YJ2 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0035000000083 KM10 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0063000000076 TM4 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0028000000058 GS4 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0016000000071 DQ8 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0022000000070 FAMICHN00002 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0070000000060 YJ1 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0032000000087 GS8 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0047000000041 LJ2 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0009000000068 DQ1 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0018000000168 FAMBBEM00001 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0011000000071 DQ3 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0023000000069 FAMICHN00003 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0077000000074 YJ8 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0030000000080 GS6 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0068000000057 TM9 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0075000000066 YJ6 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0004000000060 Basenji G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0019000000082 FAMBGSD00001 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0046000000069 LJ1 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0052000000068 LJ7 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0062000000057 TM3 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0053000000078 LJ8 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0025000000089 GS1 G ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
snp_cf0076000000072 YJ7 R ACTGATCATGAAAAAGAAATTAACTTTGAT CACTTTAGTGAAGAGACATAATAATTTAGA 2014-07-19 2014-07-19
6.Fasta Information
CCAAAGATCT GCATTGGAGA ACTGATCATG AAAAAGAAAT TAACTTTGAT
G
CACTTTAGTG AAGAGACATA ATAATTTAGA GGAAAGTATT ATAAATATAA