e.g. 1:1246..9423
SNP Detail For snp_cf0026000000061    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026000000061
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: TAAAGTATTAAAATAAGGTGGGTTTTGATG
3'flank: GCCAGAAATACTAGAATTTAACAGCTAATT
3.Reference Map information
Chrom Position Reference GS2
Chr1 276649 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000001 45532 - T intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0032000000089 GS8 Y TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0057000000068 LUPWRUS00002 C TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0025000000091 GS1 Y TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0024000000062 GS10 C TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0042000000110 KM7 Y TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0027000000093 GS3 Y TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0033000000082 GS9 Y TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0029000000060 GS5 C TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0030000000082 GS6 Y TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0050000000078 LJ5 Y TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0019000000084 FAMBGSD00001 Y TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0040000000095 KM5 Y TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0028000000059 GS4 C TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
snp_cf0031000000063 GS7 C TAAAGTATTAAAATAAGGTGGGTTTTGATG GCCAGAAATACTAGAATTTAACAGCTAATT 2014-07-19 2014-07-19
6.Fasta Information
TCCAACTTGA ATTCAAAGTT TAAAGTATTA AAATAAGGTG GGTTTTGATG
C
GCCAGAAATA CTAGAATTTA ACAGCTAATT AAAGCTAATT CAAGCTATCC