e.g. 1:1246..9423
SNP Detail For snp_cf0026000000062    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026000000062
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GTGTGGGAAATATCAGAAAGGGAGACAGAA
3'flank: ATAAAGACTCCTAACTCTGGGAAACGAACT
3.Reference Map information
Chrom Position Reference GS2
Chr1 300719 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000001 21462 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0021000000081 FAMICHN00001 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0025000000094 GS1 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0041000000098 KM6 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0042000000116 KM7 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0006000000072 CRW Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0027000000096 GS3 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0024000000063 GS10 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0028000000060 GS4 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0055000000063 LUPWCHN00001 T GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0030000000086 GS6 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0033000000086 GS9 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0029000000061 GS5 T GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0043000000195 KM8 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0065000000188 TM6 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0048000000075 LJ3 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0032000000092 GS8 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0057000000071 LUPWRUS00002 T GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0031000000064 GS7 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0040000000098 KM5 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
snp_cf0050000000081 LJ5 Y GTGTGGGAAATATCAGAAAGGGAGACAGAA ATAAAGACTCCTAACTCTGGGAAACGAACT 2014-07-19 2014-07-19
6.Fasta Information
TAAGGGAAGG GAGAAGAAAT GTGTGGGAAA TATCAGAAAG GGAGACAGAA
Y
ATAAAGACTC CTAACTCTGG GAAACGAACT AGGGGTGATG GAAGGGGAGG