e.g. 1:1246..9423
SNP Detail For snp_cf0026000000066    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026000000066
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs21882976  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: AAAAATAAAAAATAAATAAATAAATAAATT
3'flank: AAAAAAAATTAAAAAAAGGTGTTGATGACC
3.Reference Map information
Chrom Position Reference GS2
Chr1 319910 T A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000001 2271 - T intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0006000000077 CRW A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0018000000191 FAMBBEM00001 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0070000000071 YJ1 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0054000000069 LJ9 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0009000000075 DQ1 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0061000000078 TM2 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0032000000097 GS8 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0076000000078 YJ7 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0037000000084 KM2 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0060000000069 TM1 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0074000000092 YJ5 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0017000000068 DQ9 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0027000000101 GS3 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0046000000077 LJ1 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0019000000091 FAMBGSD00001 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0005000000059 CHW A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0049000000084 LJ4 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0052000000075 LJ7 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0024000000067 GS10 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0065000000204 TM6 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0050000000085 LJ5 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0053000000089 LJ8 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0044000000088 KM9 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0029000000065 GS5 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0057000000075 LUPWRUS00002 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0055000000068 LUPWCHN00001 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0064000000085 TM5 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0010000000078 DQ2 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0045000000081 LJ10 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0007000000069 Dingo A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0031000000068 GS7 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0067000000073 TM8 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0022000000084 FAMICHN00002 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0063000000084 TM4 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0058000000090 LUPWRUS00003 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0035000000093 KM10 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0015000000094 DQ7 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0028000000064 GS4 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0013000000069 DQ5 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0014000000081 DQ6 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0059000000073 TM10 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0030000000090 GS6 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0008000000044 DQ10 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0042000000123 KM7 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0033000000090 GS9 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0004000000068 Basenji A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0011000000080 DQ3 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0062000000064 TM3 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0043000000210 KM8 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0039000000095 KM4 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0075000000076 YJ6 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0072000000071 YJ3 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0021000000084 FAMICHN00001 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0038000000083 KM3 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0016000000078 DQ8 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0066000000079 TM7 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0003000000183 dbSNP139 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0025000000099 GS1 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0051000000054 LJ6 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0048000000078 LJ3 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0041000000104 KM6 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0078000000092 YJ9 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0073000000089 YJ4 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0069000000071 YJ10 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0068000000064 TM9 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0040000000103 KM5 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0020000000087 FAMBTIM00001 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0077000000082 YJ8 W AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0036000000083 KM1 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0071000000074 YJ2 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0034000000187 ISW A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
snp_cf0012000000077 DQ4 A AAAAATAAAAAATAAATAAATAAATAAATT AAAAAAAATTAAAAAAAGGTGTTGATGACC 2014-07-19 2014-07-19
6.Fasta Information
ATTATTTCAC TAAAAAAATA AAAAATAAAA AATAAATAAA TAAATAAATT
A
AAAAAAAATT AAAAAAAGGT GTTGATGACC AACTTGAAAA AAGGAATCCC