e.g. 1:1246..9423
SNP Detail For snp_cf0026000000067    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026000000067
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CAGGTCCATGGGGGCCAGCAAGGCCGCGGC
3'flank: GCCTGCCCATCCCCCGGCGCCGCGGCGGCT
3.Reference Map information
Chrom Position Reference GS2
Chr1 321956 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000001 225 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000001 108 GCA => GCG ENSCAFP00000000001 36 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0001000000145 solidGW1 Y CAGGTCCATGGGGGCCAGCAAGGCCGCGGC GCCTGCCCATCCCCCGGCGCCGCGGCGGCT 2014-08-01 2014-08-01
snp_cf0042000000124 KM7 C CAGGTCCATGGGGGCCAGCAAGGCCGCGGC GCCTGCCCATCCCCCGGCGCCGCGGCGGCT 2014-07-19 2014-07-19
snp_cf0040000000104 KM5 C CAGGTCCATGGGGGCCAGCAAGGCCGCGGC GCCTGCCCATCCCCCGGCGCCGCGGCGGCT 2014-07-19 2014-07-19
snp_cf0031000000069 GS7 C CAGGTCCATGGGGGCCAGCAAGGCCGCGGC GCCTGCCCATCCCCCGGCGCCGCGGCGGCT 2014-07-19 2014-07-19
snp_cf0061000000079 TM2 Y CAGGTCCATGGGGGCCAGCAAGGCCGCGGC GCCTGCCCATCCCCCGGCGCCGCGGCGGCT 2014-07-19 2014-07-19
snp_cf0043000000214 KM8 C CAGGTCCATGGGGGCCAGCAAGGCCGCGGC GCCTGCCCATCCCCCGGCGCCGCGGCGGCT 2014-07-19 2014-07-19
snp_cf0025000000100 GS1 C CAGGTCCATGGGGGCCAGCAAGGCCGCGGC GCCTGCCCATCCCCCGGCGCCGCGGCGGCT 2014-07-19 2014-07-19
snp_cf0065000000207 TM6 C CAGGTCCATGGGGGCCAGCAAGGCCGCGGC GCCTGCCCATCCCCCGGCGCCGCGGCGGCT 2014-07-19 2014-07-19
snp_cf0078000000093 YJ9 Y CAGGTCCATGGGGGCCAGCAAGGCCGCGGC GCCTGCCCATCCCCCGGCGCCGCGGCGGCT 2014-07-19 2014-07-19
6.Fasta Information
TTCTCCAGCG GCTCCTCCCC CAGGTCCATG GGGGCCAGCA AGGCCGCGGC
C
GCCTGCCCAT CCCCCGGCGC CGCGGCGGCT CGAGCGCAGC CCGGGTCGGG