e.g. 1:1246..9423
SNP Detail For snp_cf0026000000136    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026000000136
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs21953111  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG
3'flank: TAACTTTGAACTATTCTGGCCATTTCTGGG
3.Reference Map information
Chrom Position Reference GS2
Chr1 521119 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000005 11995 + C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0012000000150 DQ4 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0045000000149 LJ10 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0009000000154 DQ1 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0003000000358 dbSNP139 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0047000000096 LJ2 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0057000000149 LUPWRUS00002 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0029000000138 GS5 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0076000000158 YJ7 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0058000000231 LUPWRUS00003 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0060000000143 TM1 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0077000000164 YJ8 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0027000000199 GS3 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0018000000394 FAMBBEM00001 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0055000000198 LUPWCHN00001 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0078000000181 YJ9 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0049000000166 LJ4 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0052000000152 LJ7 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0044000000169 KM9 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0035000000182 KM10 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0001000000206 solidGW1 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-08-01 2014-08-01
snp_cf0063000000171 TM4 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0006000000146 CRW T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0025000000197 GS1 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0066000000150 TM7 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0028000000133 GS4 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0016000000159 DQ8 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0024000000140 GS10 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0005000000132 CHW T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0010000000152 DQ2 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0054000000137 LJ9 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0036000000176 KM1 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0041000000204 KM6 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0075000000167 YJ6 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0040000000202 KM5 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0053000000179 LJ8 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0050000000159 LJ5 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0007000000144 Dingo T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0032000000192 GS8 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0043000000426 KM8 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0067000000151 TM8 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0019000000187 FAMBGSD00001 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0030000000179 GS6 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0031000000141 GS7 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0002000000223 CID1 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-08-02 2014-08-02
snp_cf0065000000418 TM6 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0021000000156 FAMICHN00001 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0034000000366 ISW Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0073000000173 YJ4 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0013000000148 DQ5 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0014000000160 DQ6 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0064000000175 TM5 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0074000000181 YJ5 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0062000000142 TM3 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0011000000152 DQ3 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0072000000152 YJ3 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0071000000149 YJ2 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0048000000159 LJ3 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0042000000236 KM7 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0061000000168 TM2 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0015000000185 DQ7 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0023000000145 FAMICHN00003 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0070000000146 YJ1 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0037000000171 KM2 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0068000000134 TM9 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0004000000136 Basenji T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0046000000150 LJ1 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0039000000185 KM4 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0059000000155 TM10 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0017000000150 DQ9 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0033000000177 GS9 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0056000000372 LUPWRUS00001 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0020000000169 FAMBTIM00001 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0038000000174 KM3 Y CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
snp_cf0069000000147 YJ10 T CCAGCCCCTTGGGCCTTTGTAAGCAAGGGG TAACTTTGAACTATTCTGGCCATTTCTGGG 2014-07-19 2014-07-19
6.Fasta Information
CTCTGCAAGA ACGAGGAATG CCAGCCCCTT GGGCCTTTGT AAGCAAGGGG
T
TAACTTTGAA CTATTCTGGC CATTTCTGGG GATGGGCAGC CACAGGTGTG