e.g. 1:1246..9423
SNP Detail For snp_cf0026001098332    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026001098332
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: AGAGATGGTGCCAGTGAAGGCGGCGGTGGC
3'flank: GCAGCAAAGACGGAGAAAAGGACGCTTCTC
3.Reference Map information
Chrom Position Reference GS2
Chr19 1092840 A T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003624 266165 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005827 1678 AGC => TGC ENSCAFP00000005396 560 S => C
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0025001105199 GS1 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0029001043985 GS5 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0017001436571 DQ9 W AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0028001057838 GS4 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0032001090177 GS8 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0045001280045 LJ10 W AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0024001147926 GS10 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0019001097149 FAMBGSD00001 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0030001109370 GS6 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0033001112947 GS9 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0031001108607 GS7 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0075001460824 YJ6 W AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0027001110311 GS3 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
snp_cf0040001266191 KM5 T AGAGATGGTGCCAGTGAAGGCGGCGGTGGC GCAGCAAAGACGGAGAAAAGGACGCTTCTC 2014-07-19 2014-07-19
6.Fasta Information
TGGTGGATAA ACTGATTGCA AGAGATGGTG CCAGTGAAGG CGGCGGTGGC
T
GCAGCAAAGA CGGAGAAAAG GACGCTTCTC CAGTGGACCC CATCACAGCT