e.g. 1:1246..9423
SNP Detail For snp_cf0026001098959    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026001098959
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: TCCTCGAAGAGCTAGAAAAGAAACTTACCA
3'flank: CATTGCAAGGCCAGTACTGTACACACCAGC
3.Reference Map information
Chrom Position Reference GS2
Chr19 1744667 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003630 5366 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000005844 289 ATG => GTG ENSCAFP00000005413 97 M => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0039001164590 KM4 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0031001109231 GS7 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0038001108877 KM3 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0048001351808 LJ3 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0043001193327 KM8 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0047001378358 LJ2 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0070001509131 YJ1 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0074001445236 YJ5 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0064001436546 TM5 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0010001407758 DQ2 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0075001462224 YJ6 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0005001737640 CHW C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0057001720174 LUPWRUS00002 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0014001412519 DQ6 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0024001148551 GS10 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0025001105827 GS1 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0063001407489 TM4 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0002000939517 CID1 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-08-02 2014-08-02
snp_cf0054001270791 LJ9 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0021001355962 FAMICHN00001 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0029001044614 GS5 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0060001423291 TM1 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0052001394755 LJ7 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0050001322586 LJ5 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0007001221682 Dingo C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0065001404615 TM6 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0058001792108 LUPWRUS00003 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0004001190872 Basenji C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0006001660018 CRW C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0056001807045 LUPWRUS00001 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0008001418394 DQ10 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0001000625466 solidGW1 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-08-01 2014-08-01
snp_cf0045001281306 LJ10 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0077001445973 YJ8 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0046001320546 LJ1 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0049001442532 LJ4 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0020001415096 FAMBTIM00001 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0009001428784 DQ1 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0016001426976 DQ8 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0036001113184 KM1 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0053001386919 LJ8 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0017001438094 DQ9 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0018001200797 FAMBBEM00001 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0022001287516 FAMICHN00002 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0078001456284 YJ9 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0041001430443 KM6 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0011001449990 DQ3 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0028001058463 GS4 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0030001109998 GS6 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0051001424969 LJ6 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0069001475399 YJ10 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0032001090803 GS8 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0035001376281 KM10 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0055001788829 LUPWCHN00001 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0037001207644 KM2 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0076001473860 YJ7 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0033001113571 GS9 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0071001459017 YJ2 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0042001481243 KM7 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0067001398717 TM8 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0072001466835 YJ3 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0061001449957 TM2 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0015001425420 DQ7 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0012001423781 DQ4 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0073001414368 YJ4 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0040001266821 KM5 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0044001260798 KM9 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0019001097777 FAMBGSD00001 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0068001380808 TM9 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0023001331534 FAMICHN00003 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0027001110938 GS3 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0013001369099 DQ5 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0066001457975 TM7 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0062001439217 TM3 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
snp_cf0059001425042 TM10 C TCCTCGAAGAGCTAGAAAAGAAACTTACCA CATTGCAAGGCCAGTACTGTACACACCAGC 2014-07-19 2014-07-19
6.Fasta Information
TCTTATCCTT GGAAACCTGT TCCTCGAAGA GCTAGAAAAG AAACTTACCA
C
CATTGCAAGG CCAGTACTGT ACACACCAGC ATGCTTTATG ACACAGTCTG