e.g. 1:1246..9423
SNP Detail For snp_cf0026001100946    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026001100946
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GACCCACGGTCATGCGACATCCACACCAAC
3'flank: TGAGCATGGAGTCGGTTCCCCACACGGAGT
3.Reference Map information
Chrom Position Reference GS2
Chr19 4969768 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003758 1836 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000006044 1720 GTG => ATG ENSCAFP00000005600 574 V => M
+ ENSCAFT00000050034 1819 GTG => ATG ENSCAFP00000036393 607 V => M
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0021001358946 FAMICHN00001 R GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0031001111215 GS7 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0033001115550 GS9 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0045001283756 LJ10 R GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0019001099757 FAMBGSD00001 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0075001465545 YJ6 R GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0027001112928 GS3 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0028001060443 GS4 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0030001111986 GS6 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0040001268806 KM5 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0024001150534 GS10 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0025001107805 GS1 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0017001441110 DQ9 R GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0029001046594 GS5 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
snp_cf0032001092799 GS8 A GACCCACGGTCATGCGACATCCACACCAAC TGAGCATGGAGTCGGTTCCCCACACGGAGT 2014-07-19 2014-07-19
6.Fasta Information
AGGAGAACAC CTTCCTAATT GACCCACGGT CATGCGACAT CCACACCAAC
A
TGAGCATGGA GTCGGTTCCC CACACGGAGT GGGAGCTCGC CGTTGTCATC