e.g. 1:1246..9423
SNP Detail For snp_cf0026001110147    [See in GBrowse]
1.General Information
SNP ID: snp_cf0026001110147
Organism: Canis familiaris
Individual: GS2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT
3'flank: TTGTCTCCTCGGCCGTCCCGCCCGATTCTT
3.Reference Map information
Chrom Position Reference GS2
Chr19 13156649 T A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003896 215 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000006283 215 AAA => ATA ENSCAFP00000005822 72 K => I
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073001432744 YJ4 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0028001069653 GS4 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0009001446597 DQ1 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0064001455341 TM5 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0047001396307 LJ2 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0059001440307 TM10 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0062001457975 TM3 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0077001464865 YJ8 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0042001502208 KM7 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0043001213853 KM8 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0006001685848 CRW A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0019001110197 FAMBGSD00001 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0070001528401 YJ1 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0051001441123 LJ6 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0053001405456 LJ8 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0046001340091 LJ1 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0036001130971 KM1 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0004001209496 Basenji A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0078001475811 YJ9 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0007001239107 Dingo A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0069001492904 YJ10 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0054001287745 LJ9 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0005001765502 CHW A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0066001476581 TM7 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0010001426369 DQ2 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0025001117009 GS1 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0076001492516 YJ7 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0035001398634 KM10 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0016001446493 DQ8 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0013001381502 DQ5 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0044001278258 KM9 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0067001417814 TM8 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0071001477450 YJ2 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0074001464971 YJ5 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0063001427388 TM4 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0008001436836 DQ10 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0031001120415 GS7 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0017001455280 DQ9 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0045001299543 LJ10 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0018001217630 FAMBBEM00001 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0021001374592 FAMICHN00001 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0023001346226 FAMICHN00003 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0056001834035 LUPWRUS00001 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0072001485442 YJ3 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0060001436157 TM1 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0037001219781 KM2 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0038001126160 KM3 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0068001398213 TM9 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0052001412636 LJ7 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0020001433873 FAMBTIM00001 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0027001123397 GS3 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0057001744517 LUPWRUS00002 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0029001055795 GS5 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0055001811464 LUPWCHN00001 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0065001423196 TM6 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0075001480958 YJ6 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0040001278005 KM5 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0032001102744 GS8 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0030001121191 GS6 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0033001124764 GS9 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0041001450725 KM6 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0049001460706 LJ4 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0039001181592 KM4 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0014001425376 DQ6 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0015001443350 DQ7 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0012001442434 DQ4 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0061001468783 TM2 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0011001467590 DQ3 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
snp_cf0024001159745 GS10 A GCTCCCCGTTCCCTCTCTCCCAGCTCTTCT TTGTCTCCTCGGCCGTCCCGCCCGATTCTT 2014-07-19 2014-07-19
6.Fasta Information
CCGCGGTCAC GTCTTCGTGG GCTCCCCGTT CCCTCTCTCC CAGCTCTTCT
A
TTGTCTCCTC GGCCGTCCCG CCCGATTCTT TGTGTGTCTC CTGCTTCCTC