e.g. 1:1246..9423
SNP Detail For snp_cf0027000000002    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027000000002
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: TTGAACGCCATGTCCAATAGCATCTCCCTT
3'flank: TGAGAGTTGAGCTCACCCTCAGTCCCTCAC
3.Reference Map information
Chrom Position Reference GS3
Chr1 8986 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0054000000001 LJ9 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0016000000007 DQ8 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0022000000001 FAMICHN00002 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0051000000007 LJ6 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0042000000002 KM7 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0068000000001 TM9 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0060000000004 TM1 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0077000000004 YJ8 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0053000000003 LJ8 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0059000000002 TM10 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0050000000005 LJ5 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0002000000035 CID1 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-08-02 2014-08-02
snp_cf0047000000001 LJ2 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0044000000001 KM9 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0009000000006 DQ1 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0015000000005 DQ7 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0021000000002 FAMICHN00001 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0035000000004 KM10 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0070000000003 YJ1 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0023000000004 FAMICHN00003 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0017000000004 DQ9 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0058000000005 LUPWRUS00003 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0073000000004 YJ4 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0043000000001 KM8 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0040000000004 KM5 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0005000000007 CHW C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0014000000005 DQ6 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0020000000001 FAMBTIM00001 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0052000000001 LJ7 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0046000000004 LJ1 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0031000000002 GS7 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0011000000005 DQ3 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0066000000004 TM7 Y TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
snp_cf0075000000004 YJ6 C TTGAACGCCATGTCCAATAGCATCTCCCTT TGAGAGTTGAGCTCACCCTCAGTCCCTCAC 2014-07-19 2014-07-19
6.Fasta Information
TTGCATACGT GAGAAGGTAG TTGAACGCCA TGTCCAATAG CATCTCCCTT
C
TGAGAGTTGA GCTCACCCTC AGTCCCTCAC AGTTCCACAC TGCCTGCAGA