e.g. 1:1246..9423
SNP Detail For snp_cf0027000000003    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027000000003
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GTTTCGCACGTCTTCACCAGAGACGTTTGC
3'flank: AGAGGCTTCTGAGCGCAAGTTAACAATGCA
3.Reference Map information
Chrom Position Reference GS3
Chr1 9071 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0050000000006 LJ5 Y GTTTCGCACGTCTTCACCAGAGACGTTTGC AGAGGCTTCTGAGCGCAAGTTAACAATGCA 2014-07-19 2014-07-19
snp_cf0042000000003 KM7 Y GTTTCGCACGTCTTCACCAGAGACGTTTGC AGAGGCTTCTGAGCGCAAGTTAACAATGCA 2014-07-19 2014-07-19
snp_cf0031000000003 GS7 T GTTTCGCACGTCTTCACCAGAGACGTTTGC AGAGGCTTCTGAGCGCAAGTTAACAATGCA 2014-07-19 2014-07-19
snp_cf0011000000006 DQ3 Y GTTTCGCACGTCTTCACCAGAGACGTTTGC AGAGGCTTCTGAGCGCAAGTTAACAATGCA 2014-07-19 2014-07-19
snp_cf0021000000003 FAMICHN00001 T GTTTCGCACGTCTTCACCAGAGACGTTTGC AGAGGCTTCTGAGCGCAAGTTAACAATGCA 2014-07-19 2014-07-19
6.Fasta Information
CCACACTGCC TGCAGAGTGA GTTTCGCACG TCTTCACCAG AGACGTTTGC
T
AGAGGCTTCT GAGCGCAAGT TAACAATGCA GTTGGAAGTT ATCTCCAGGT