e.g. 1:1246..9423
SNP Detail For snp_cf0027001203471    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027001203471
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA
3'flank: TGTGATGTAATTGGTTTTGTCTTATGTATA
3.Reference Map information
Chrom Position Reference GS3
Chr2 113 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0050001437654 LJ5 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0034001820553 ISW Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0049001553037 LJ4 T NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0060001525448 TM1 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0045001395788 LJ10 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0015001542975 DQ7 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0062001556377 TM3 T NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0052001508929 LJ7 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0021001467166 FAMICHN00001 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0061001568193 TM2 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0020001532312 FAMBTIM00001 T NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0068001497137 TM9 T NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0016001543364 DQ8 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0059001534397 TM10 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0046001436005 LJ1 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0009001541530 DQ1 T NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0035001495731 KM10 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0007001327343 Dingo T NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0023001441157 FAMICHN00003 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0056001954494 LUPWRUS00001 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0067001517000 TM8 T NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0066001574529 TM7 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0012001540046 DQ4 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0030001198537 GS6 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0064001560177 TM5 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0031001203846 GS7 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0042001608791 KM7 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0048001468682 LJ3 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0078001576966 YJ9 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0077001565582 YJ8 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0040001369233 KM5 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0047001498259 LJ2 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0004001296417 Basenji T NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0058001933813 LUPWRUS00003 T NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0063001524591 TM4 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0008001535963 DQ10 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0065001524206 TM6 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0028001144408 GS4 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0026001180138 GS2 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0075001581972 YJ6 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0017001555578 DQ9 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0044001366434 KM9 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0073001532890 YJ4 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
snp_cf0029001125931 GS5 Y NNNNNNNNNNNNNNNNNNTTTTTGCCAAGA TGTGATGTAATTGGTTTTGTCTTATGTATA 2014-07-19 2014-07-19
6.Fasta Information
NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNTT TTTGCCAAGA
Y
TGTGATGTAA TTGGTTTTGT CTTATGTATA ATTAACTAGC AACAGTGTGT