e.g. 1:1246..9423
SNP Detail For snp_cf0027001203473    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027001203473
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GTTTAAAGAGATATGTTATAATAAAGTAAA
3'flank: TGAAAGTGTAAATTCTGTCATACATTGTCC
3.Reference Map information
Chrom Position Reference GS3
Chr2 296 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0020001532314 FAMBTIM00001 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0015001542977 DQ7 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0049001553039 LJ4 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0062001556379 TM3 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0066001574531 TM7 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0061001568195 TM2 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0019001182672 FAMBGSD00001 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0026001180140 GS2 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0028001144410 GS4 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0016001543366 DQ8 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0017001555580 DQ9 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0023001441159 FAMICHN00003 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0046001436007 LJ1 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0006001793936 CRW Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0009001541532 DQ1 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0030001198539 GS6 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0064001560179 TM5 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0031001203848 GS7 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0012001540048 DQ4 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0048001468684 LJ3 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0045001395790 LJ10 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0047001498261 LJ2 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0004001296419 Basenji Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0058001933815 LUPWRUS00003 C GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0063001524593 TM4 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
snp_cf0029001125933 GS5 Y GTTTAAAGAGATATGTTATAATAAAGTAAA TGAAAGTGTAAATTCTGTCATACATTGTCC 2014-07-19 2014-07-19
6.Fasta Information
GAGGGCAGAA ATTGAATACT GTTTAAAGAG ATATGTTATA ATAAAGTAAA
Y
TGAAAGTGTA AATTCTGTCA TACATTGTCC CCAATACTTA TATCAAGTCA