e.g. 1:1246..9423
SNP Detail For snp_cf0027001203475    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027001203475
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA
3'flank: TTTAAAAATCCACACTGGATTTTTCCCAGA
3.Reference Map information
Chrom Position Reference GS3
Chr2 4209 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0023001441161 FAMICHN00003 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0020001532316 FAMBTIM00001 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0066001574533 TM7 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0019001182674 FAMBGSD00001 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0063001524595 TM4 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0064001560181 TM5 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0015001542979 DQ7 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0031001203850 GS7 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0026001180142 GS2 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0062001556381 TM3 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0028001144412 GS4 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0022001402958 FAMICHN00002 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0030001198541 GS6 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0004001296422 Basenji Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0006001793938 CRW Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0046001436009 LJ1 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0017001555582 DQ9 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0009001541534 DQ1 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0049001553041 LJ4 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0048001468686 LJ3 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0045001395792 LJ10 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0047001498263 LJ2 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0016001543368 DQ8 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0061001568197 TM2 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0012001540050 DQ4 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
snp_cf0029001125935 GS5 Y CAAGAAAGCCTAGCCCAGGAGAAGCAGAAA TTTAAAAATCCACACTGGATTTTTCCCAGA 2014-07-19 2014-07-19
6.Fasta Information
GGAGGAGAAA GCCTCTGGGA CAAGAAAGCC TAGCCCAGGA GAAGCAGAAA
Y
TTTAAAAATC CACACTGGAT TTTTCCCAGA CTGAAAAGTC CTTAGCAGGG