e.g. 1:1246..9423
SNP Detail For snp_cf0027001203479    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027001203479
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: TCAAATATACAAGCTCACCTCATGCTTAAA
3'flank: CAACTGGAAAAAGAACAGCAAATAAAACCT
3.Reference Map information
Chrom Position Reference GS3
Chr2 7972 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0012001540054 DQ4 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0066001574537 TM7 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0019001182678 FAMBGSD00001 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0046001436014 LJ1 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0031001203854 GS7 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0064001560187 TM5 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0048001468691 LJ3 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0004001296428 Basenji A TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0061001568201 TM2 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0047001498267 LJ2 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0028001144416 GS4 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0017001555587 DQ9 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0049001553046 LJ4 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0026001180146 GS2 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0030001198545 GS6 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0015001542983 DQ7 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0045001395797 LJ10 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0009001541539 DQ1 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0063001524600 TM4 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0062001556386 TM3 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0020001532323 FAMBTIM00001 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0016001543372 DQ8 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0029001125939 GS5 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
snp_cf0023001441166 FAMICHN00003 R TCAAATATACAAGCTCACCTCATGCTTAAA CAACTGGAAAAAGAACAGCAAATAAAACCT 2014-07-19 2014-07-19
6.Fasta Information
CTCAAAAAAT TGTAAAAAAC TCAAATATAC AAGCTCACCT CATGCTTAAA
R
CAACTGGAAA AAGAACAGCA AATAAAACCT ACACCAAGCA GAAGAAGAGA