e.g. 1:1246..9423
SNP Detail For snp_cf0027003400927    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027003400927
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: AGAATCGAATCGAATCAAATCAAATACATT
3'flank: GAATAGAATAGAATAGAATAGAAAAATATC
3.Reference Map information
Chrom Position Reference GS3
Chr8 2683 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010004377652 DQ2 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0074004380227 YJ5 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0046004075727 LJ1 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0025003402325 GS1 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0064004395151 TM5 Y AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0043003676604 KM8 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0050004054990 LJ5 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0039003686201 KM4 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0078004444948 YJ9 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0020004310842 FAMBTIM00001 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0042004517138 KM7 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0007003698513 Dingo C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0052004293562 LJ7 Y AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0035004236789 KM10 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0053004262158 LJ8 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0019003389793 FAMBGSD00001 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0056005411026 LUPWRUS00001 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0065004328758 TM6 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0059004350509 TM10 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0006005007857 CRW C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0063004281711 TM4 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0013004292574 DQ5 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0030003388705 GS6 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0076004483339 YJ7 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0021004181810 FAMICHN00001 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0051004356021 LJ6 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0012004350821 DQ4 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0072004479091 YJ3 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0049004397291 LJ4 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0022003870245 FAMICHN00002 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0009004356868 DQ1 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0029003209657 GS5 Y AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0023004181500 FAMICHN00003 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0016004360049 DQ8 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0060004269382 TM1 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0041004329843 KM6 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0002002908688 CID1 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-08-02 2014-08-02
snp_cf0037003627211 KM2 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0066004466084 TM7 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0014004321442 DQ6 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0032003357460 GS8 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0054004007562 LJ9 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0077004439487 YJ8 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0018003626518 FAMBBEM00001 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0036003477173 KM1 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0045003997331 LJ10 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0044003845272 KM9 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0068004306679 TM9 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0008004426180 DQ10 Y AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0071004450120 YJ2 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0031003440258 GS7 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0028003292681 GS4 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0062004366349 TM3 Y AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0004003644557 Basenji C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0033003419499 GS9 Y AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0015004358777 DQ7 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0040003764889 KM5 Y AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0005005242385 CHW C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0061004420174 TM2 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0070004608032 YJ1 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0057005164422 LUPWRUS00002 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0017004406541 DQ9 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0038003531354 KM3 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0026003423802 GS2 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0073004353444 YJ4 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0075004459299 YJ6 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0047004240551 LJ2 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0034005042161 ISW C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0024003428846 GS10 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0048004155276 LJ3 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0058005365751 LUPWRUS00003 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0011004420266 DQ3 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0067004304885 TM8 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
snp_cf0069004487069 YJ10 C AGAATCGAATCGAATCAAATCAAATACATT GAATAGAATAGAATAGAATAGAAAAATATC 2014-07-19 2014-07-19
6.Fasta Information
CGAATCAAAT AGAATAGAAA AGAATCGAAT CGAATCAAAT CAAATACATT
C
GAATAGAATA GAATAGAATA GAAAAATATC GAATAGAATA GAATAGAATA