e.g. 1:1246..9423
SNP Detail For snp_cf0027003400929    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027003400929
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: AGAATTGCGCGCAGTTTTGTGGGGCACAAA
3'flank: CAGGGTTACATTGTTATGAGCCGATTTCCG
3.Reference Map information
Chrom Position Reference GS3
Chr8 6567 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0025003402328 GS1 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0010004377654 DQ2 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0042004517141 KM7 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0053004262159 LJ8 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0020004310846 FAMBTIM00001 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0043003676607 KM8 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0046004075729 LJ1 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0052004293565 LJ7 S AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0033003419501 GS9 S AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0064004395152 TM5 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0065004328760 TM6 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0072004479093 YJ3 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0074004380229 YJ5 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0050004054991 LJ5 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0016004360052 DQ8 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0019003389796 FAMBGSD00001 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0007003698514 Dingo C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0051004356023 LJ6 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0070004608033 YJ1 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0013004292576 DQ5 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0009004356870 DQ1 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0030003388706 GS6 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0063004281715 TM4 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0021004181812 FAMICHN00001 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0012004350825 DQ4 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0041004329847 KM6 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0035004236794 KM10 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0022003870248 FAMICHN00002 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0049004397292 LJ4 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0060004269383 TM1 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0031003440260 GS7 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0023004181501 FAMICHN00003 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0055005386592 LUPWCHN00001 S AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0056005411033 LUPWRUS00001 S AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0029003209659 GS5 S AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0006005007860 CRW S AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0037003627212 KM2 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0015004358781 DQ7 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0032003357461 GS8 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0054004007564 LJ9 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0036003477174 KM1 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0077004439489 YJ8 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0008004426184 DQ10 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0001001924432 solidGW1 S AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-08-01 2014-08-01
snp_cf0075004459302 YJ6 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0071004450121 YJ2 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0014004321446 DQ6 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0044003845275 KM9 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0028003292683 GS4 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0004003644558 Basenji C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0068004306683 TM9 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0076004483340 YJ7 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0059004350512 TM10 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0005005242387 CHW C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0018003626520 FAMBBEM00001 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0061004420177 TM2 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0069004487071 YJ10 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0026003423805 GS2 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0017004406542 DQ9 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0057005164424 LUPWRUS00002 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0038003531355 KM3 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0062004366352 TM3 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0039003686204 KM4 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0040003764891 KM5 S AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0073004353446 YJ4 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0011004420268 DQ3 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0034005042162 ISW C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0067004304889 TM8 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0058005365753 LUPWRUS00003 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0045003997332 LJ10 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0024003428848 GS10 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0066004466087 TM7 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0048004155278 LJ3 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0078004444951 YJ9 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
snp_cf0047004240553 LJ2 C AGAATTGCGCGCAGTTTTGTGGGGCACAAA CAGGGTTACATTGTTATGAGCCGATTTCCG 2014-07-19 2014-07-19
6.Fasta Information
GCTGGCCTAT TACTTTGGTC AGAATTGCGC GCAGTTTTGT GGGGCACAAA
C
CAGGGTTACA TTGTTATGAG CCGATTTCCG ATTAGGGTGT GCCCAGCAGC