e.g. 1:1246..9423
SNP Detail For snp_cf0027003400930    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027003400930
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: ATACACATTCCTTTCAAGTGCGCATGGGAC
3'flank: TTCTCCAGAACAGATCATATCATGGGCCAC
3.Reference Map information
Chrom Position Reference GS3
Chr8 8879 A M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0028003292684 GS4 M ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0029003209660 GS5 M ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0040003764892 KM5 M ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0042004517142 KM7 M ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0038003531356 KM3 C ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0041004329848 KM6 M ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0036003477175 KM1 C ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0031003440261 GS7 M ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0037003627214 KM2 M ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0030003388707 GS6 M ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
snp_cf0039003686205 KM4 M ATACACATTCCTTTCAAGTGCGCATGGGAC TTCTCCAGAACAGATCATATCATGGGCCAC 2014-07-19 2014-07-19
6.Fasta Information
ACATTTCGTC GTAAAGCAGA ATACACATTC CTTTCAAGTG CGCATGGGAC
M
TTCTCCAGAA CAGATCATAT CATGGGCCAC AAATCAGCCC TCAACAGGTA