e.g. 1:1246..9423
SNP Detail For snp_cf0027003400933    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027003400933
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GGGTATTATGCTGAGTGAAATGAGTCAATC
3'flank: GAAAAGGACAAACATTATATGGTCTCATTC
3.Reference Map information
Chrom Position Reference GS3
Chr8 30060 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010004377657 DQ2 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0007003698520 Dingo G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0049004397299 LJ4 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0050004054996 LJ5 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0033003419506 GS9 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0065004328765 TM6 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0064004395156 TM5 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0072004479096 YJ3 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0030003388710 GS6 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0016004360056 DQ8 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0025003402331 GS1 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0060004269390 TM1 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0041004329851 KM6 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0067004304893 TM8 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0009004356873 DQ1 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0051004356027 LJ6 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0014004321450 DQ6 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0074004380233 YJ5 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0070004608037 YJ1 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0021004181818 FAMICHN00001 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0019003389798 FAMBGSD00001 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0068004306687 TM9 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0012004350829 DQ4 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0043003676610 KM8 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0063004281719 TM4 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0061004420181 TM2 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0056005411039 LUPWRUS00001 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0023004181508 FAMICHN00003 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0031003440264 GS7 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0035004236797 KM10 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0052004293570 LJ7 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0013004292579 DQ5 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0042004517145 KM7 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0020004310850 FAMBTIM00001 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0046004075734 LJ1 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0006005007863 CRW G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0005005242390 CHW G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0008004426188 DQ10 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0032003357464 GS8 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0037003627218 KM2 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0075004459306 YJ6 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0004003644562 Basenji G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0076004483344 YJ7 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0071004450127 YJ2 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0018003626525 FAMBBEM00001 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0011004420274 DQ3 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0022003870252 FAMICHN00002 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0028003292687 GS4 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0029003209664 GS5 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0059004350516 TM10 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0054004007570 LJ9 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0077004439493 YJ8 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0026003423808 GS2 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0024003428851 GS10 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0017004406547 DQ9 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0038003531359 KM3 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0066004466091 TM7 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0048004155281 LJ3 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0062004366356 TM3 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0039003686208 KM4 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0073004353449 YJ4 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0044003845278 KM9 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0078004444954 YJ9 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0058005365756 LUPWRUS00003 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0036003477178 KM1 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0034005042165 ISW G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0057005164427 LUPWRUS00002 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0053004262163 LJ8 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0047004240557 LJ2 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0015004358785 DQ7 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0045003997336 LJ10 R GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
snp_cf0040003764896 KM5 G GGGTATTATGCTGAGTGAAATGAGTCAATC GAAAAGGACAAACATTATATGGTCTCATTC 2014-07-19 2014-07-19
6.Fasta Information
TCAATGTGGA TGGAACTGGA GGGTATTATG CTGAGTGAAA TGAGTCAATC
G
GAAAAGGACA AACATTATAT GGTCTCATTC ATTTGGGGAA TATAAAAATT