e.g. 1:1246..9423
SNP Detail For snp_cf0027003400935    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027003400935
Organism: Canis familiaris
Individual: GS3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CCACCCCTTCTGAAAATCCCCTAGACCAGC
3'flank: TATAAAAAAACCCAGCTGTAACCCACTTCT
3.Reference Map information
Chrom Position Reference GS3
Chr8 32675 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0007003698522 Dingo G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0063004281721 TM4 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0010004377659 DQ2 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0072004479098 YJ3 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0050004054999 LJ5 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0033003419508 GS9 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0064004395159 TM5 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0065004328767 TM6 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0012004350831 DQ4 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0030003388712 GS6 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0016004360059 DQ8 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0060004269392 TM1 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0023004181510 FAMICHN00003 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0024003428853 GS10 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0041004329854 KM6 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0017004406549 DQ9 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0067004304895 TM8 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0043003676612 KM8 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0046004075738 LJ1 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0052004293574 LJ7 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0051004356029 LJ6 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0014004321452 DQ6 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0074004380235 YJ5 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0025003402333 GS1 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0070004608039 YJ1 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0068004306689 TM9 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0061004420183 TM2 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0035004236799 KM10 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0031003440266 GS7 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0055005386596 LUPWCHN00001 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0020004310852 FAMBTIM00001 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0042004517148 KM7 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0059004350518 TM10 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0075004459308 YJ6 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0013004292581 DQ5 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0006005007865 CRW S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0032003357466 GS8 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0019003389800 FAMBGSD00001 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0005005242392 CHW G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0026003423810 GS2 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0073004353451 YJ4 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0004003644564 Basenji G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0021004181820 FAMICHN00001 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0076004483346 YJ7 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0037003627220 KM2 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0071004450129 YJ2 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0056005411041 LUPWRUS00001 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0022003870254 FAMICHN00002 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0077004439495 YJ8 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0011004420276 DQ3 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0028003292689 GS4 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0009004356875 DQ1 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0029003209666 GS5 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0054004007572 LJ9 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0036003477180 KM1 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0066004466093 TM7 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0044003845280 KM9 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0018003626529 FAMBBEM00001 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0048004155283 LJ3 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0062004366358 TM3 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0049004397301 LJ4 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0039003686210 KM4 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0008004426190 DQ10 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0058005365758 LUPWRUS00003 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0078004444956 YJ9 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0057005164429 LUPWRUS00002 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0040003764899 KM5 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0053004262165 LJ8 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0047004240559 LJ2 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0038003531361 KM3 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0015004358787 DQ7 G CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
snp_cf0045003997338 LJ10 S CCACCCCTTCTGAAAATCCCCTAGACCAGC TATAAAAAAACCCAGCTGTAACCCACTTCT 2014-07-19 2014-07-19
6.Fasta Information
ACAGAACTTG AGAAATTCCT CCACCCCTTC TGAAAATCCC CTAGACCAGC
G
TATAAAAAAA CCCAGCTGTA ACCCACTTCT GGGTCCAAGT CCCTGCTCTG