e.g. 1:1246..9423
SNP Detail For snp_cf0028000000010    [See in GBrowse]
1.General Information
SNP ID: snp_cf0028000000010
Organism: Canis familiaris
Individual: GS4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: AGGGATCCCTGGGTGGCGCAGCGGTTTAGC
3'flank: CCTGCCTTTGGCCCAGGGCGCGATCCTAGA
3.Reference Map information
Chrom Position Reference GS4
Chr1 47865 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0042000000019 KM7 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0048000000019 LJ3 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0057000000016 LUPWRUS00002 G AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0026000000012 GS2 G AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0032000000016 GS8 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0030000000011 GS6 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0033000000011 GS9 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0056000000014 LUPWRUS00001 G AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0027000000019 GS3 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0031000000014 GS7 G AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0024000000013 GS10 G AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0058000000020 LUPWRUS00003 G AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0043000000019 KM8 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0025000000017 GS1 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0029000000011 GS5 G AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0021000000020 FAMICHN00001 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0040000000020 KM5 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0006000000017 CRW G AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0034000000024 ISW R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
snp_cf0065000000019 TM6 R AGGGATCCCTGGGTGGCGCAGCGGTTTAGC CCTGCCTTTGGCCCAGGGCGCGATCCTAGA 2014-07-19 2014-07-19
6.Fasta Information
CAGCTAAGAA GAAGCATTCT AGGGATCCCT GGGTGGCGCA GCGGTTTAGC
G
CCTGCCTTTG GCCCAGGGCG CGATCCTAGA GACCCGGGAT CGAATCCCAC