e.g. 1:1246..9423
SNP Detail For snp_cf0028000383804    [See in GBrowse]
1.General Information
SNP ID: snp_cf0028000383804
Organism: Canis familiaris
Individual: GS4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: AGAAGATAACCAGCCTGGGGAGAAGAGAAG
3'flank: TGCTTAAGGAGAAGGAGCACAGCACCAAGC
3.Reference Map information
Chrom Position Reference GS4
Chr12 401400 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030478 4360 + C NON_CDS
ENSCAFG00000030478 4360 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000632 169 CTG => GTG ENSCAFP00000000577 57 L => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0074000516306 YJ5 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0017000523253 DQ9 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0068000494553 TM9 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0044000444699 KM9 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0060000521677 TM1 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0042000497329 KM7 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0066000515790 TM7 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0027000386704 GS3 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0038000404762 KM3 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0010000505010 DQ2 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0040000440762 KM5 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0019000386318 FAMBGSD00001 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0041000482932 KM6 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0056000652246 LUPWRUS00001 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0061000515131 TM2 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0070000535041 YJ1 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0023000476401 FAMICHN00003 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0024000419489 GS10 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0014000499249 DQ6 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0018000418799 FAMBBEM00001 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0039000402322 KM4 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0069000527785 YJ10 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0064000514823 TM5 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0007000423865 Dingo G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0036000396753 KM1 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0049000520891 LJ4 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0054000456868 LJ9 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0006000592737 CRW G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0071000519602 YJ2 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0051000506127 LJ6 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0073000514539 YJ4 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0076000524112 YJ7 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0035000478037 KM10 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0055000647163 LUPWCHN00001 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0065000482908 TM6 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0008000502015 DQ10 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0015000506829 DQ7 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0072000524721 YJ3 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0029000337540 GS5 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0050000457709 LJ5 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0053000493000 LJ8 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0046000454622 LJ1 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0063000506930 TM4 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0005000627127 CHW G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0048000482201 LJ3 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0012000504252 DQ4 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0033000406140 GS9 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0009000505865 DQ1 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0059000515889 TM10 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0052000492986 LJ7 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0026000389817 GS2 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0004000420898 Basenji G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0043000412740 KM8 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0077000519767 YJ8 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0032000383074 GS8 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0037000412109 KM2 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0020000500304 FAMBTIM00001 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0016000509421 DQ8 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0025000371774 GS1 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0047000477453 LJ2 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0062000516894 TM3 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0067000502897 TM8 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0031000390120 GS7 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0034000617332 ISW G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0021000482457 FAMICHN00001 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0057000631185 LUPWRUS00002 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0013000501713 DQ5 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0045000438787 LJ10 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0011000511582 DQ3 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0030000395445 GS6 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0075000528329 YJ6 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0058000642111 LUPWRUS00003 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0078000522207 YJ9 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
snp_cf0022000471452 FAMICHN00002 G AGAAGATAACCAGCCTGGGGAGAAGAGAAG TGCTTAAGGAGAAGGAGCACAGCACCAAGC 2014-07-19 2014-07-19
6.Fasta Information
TTCTTTGAGG AAAAAAAAAT AGAAGATAAC CAGCCTGGGG AGAAGAGAAG
G
TGCTTAAGGA GAAGGAGCAC AGCACCAAGC AGGTTCAAGT GTCAGGGGGT