e.g. 1:1246..9423
SNP Detail For snp_cf0028000383846    [See in GBrowse]
1.General Information
SNP ID: snp_cf0028000383846
Organism: Canis familiaris
Individual: GS4
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24733901  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: TGTATGTGCTCAAAGACACTTCGGCACGAC
3'flank: GTGAGTGCCAGATGCCCTTCCATCCATACT
3.Reference Map information
Chrom Position Reference GS4
Chr12 442727 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000414 830 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000652 260 CTG => CCG ENSCAFP00000000597 87 L => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0016000509498 DQ8 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0072000524785 YJ3 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0062000516946 TM3 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0053000493065 LJ8 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0048000482263 LJ3 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0031000390214 GS7 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0063000506996 TM4 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0054000456937 LJ9 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0049000520961 LJ4 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0024000419550 GS10 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0059000515944 TM10 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0033000406202 GS9 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0065000482963 TM6 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0005000627183 CHW C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0035000478103 KM10 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0058000642203 LUPWRUS00003 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0078000522271 YJ9 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0052000493087 LJ7 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0020000500381 FAMBTIM00001 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0041000483017 KM6 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0044000444746 KM9 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0012000504316 DQ4 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0068000494604 TM9 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0045000438837 LJ10 Y TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0025000371838 GS1 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0066000515859 TM7 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0008000502081 DQ10 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0036000396807 KM1 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0015000506909 DQ7 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0018000418843 FAMBBEM00001 Y TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0051000506182 LJ6 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0029000337584 GS5 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0039000402376 KM4 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0046000454701 LJ1 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0001000250983 solidGW1 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-08-01 2014-08-01
snp_cf0002000332858 CID1 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-08-02 2014-08-02
snp_cf0042000497426 KM7 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0038000404823 KM3 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0013000501792 DQ5 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0060000521732 TM1 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0017000523308 DQ9 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0070000535104 YJ1 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0073000514603 YJ4 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0061000515196 TM2 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0023000476481 FAMICHN00003 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0043000412784 KM8 Y TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0047000477518 LJ2 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0004000420972 Basenji C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0074000516373 YJ5 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0007000423926 Dingo C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0050000457784 LJ5 Y TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0056000652302 LUPWRUS00001 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0009000505944 DQ1 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0027000386799 GS3 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0006000592799 CRW C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0026000389871 GS2 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0037000412163 KM2 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0075000528410 YJ6 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0014000499304 DQ6 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0064000514887 TM5 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0071000519665 YJ2 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0034000617409 ISW C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0067000502978 TM8 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0010000505067 DQ2 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0003000276030 dbSNP139 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0019000386399 FAMBGSD00001 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0022000471499 FAMICHN00002 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0040000440816 KM5 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0021000482534 FAMICHN00001 Y TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0011000511661 DQ3 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0032000383128 GS8 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0057000631265 LUPWRUS00002 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0030000395489 GS6 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0076000524177 YJ7 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0055000647225 LUPWCHN00001 C TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
snp_cf0069000527837 YJ10 Y TGTATGTGCTCAAAGACACTTCGGCACGAC GTGAGTGCCAGATGCCCTTCCATCCATACT 2014-07-19 2014-07-19
6.Fasta Information
GCAGAGTAAT CGCCATGTTA TGTATGTGCT CAAAGACACT TCGGCACGAC
C
GTGAGTGCCA GATGCCCTTC CATCCATACT TTATTCCTTC CTTCCCCAAC