e.g. 1:1246..9423
SNP Detail For snp_cf0028000383887    [See in GBrowse]
1.General Information
SNP ID: snp_cf0028000383887
Organism: Canis familiaris
Individual: GS4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CATCCTCAGATTCTGGCTTCTCAGTCTGTT
3'flank: ACTCCCCCTGCAAACCAGTCCAAAGGATTA
3.Reference Map information
Chrom Position Reference GS4
Chr12 475602 T G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000427 2214 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000685 460 AAA => CAA ENSCAFP00000000629 154 K => Q
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0008000502158 DQ10 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0072000524862 YJ3 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0053000493140 LJ8 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0024000419594 GS10 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0019000386486 FAMBGSD00001 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0052000493179 LJ7 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0059000515985 TM10 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0031000390299 GS7 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0026000389911 GS2 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0030000395535 GS6 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0033000406246 GS9 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0034000617483 ISW G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0012000504394 DQ4 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0016000509567 DQ8 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0010000505125 DQ2 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0047000477594 LJ2 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0029000337630 GS5 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0005000627236 CHW G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0068000494645 TM9 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0048000482335 LJ3 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0058000642290 LUPWRUS00003 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0045000438883 LJ10 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0063000507069 TM4 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0067000503054 TM8 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0020000500455 FAMBTIM00001 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0078000522348 YJ9 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0066000515939 TM7 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0023000476555 FAMICHN00003 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0075000528488 YJ6 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0027000386883 GS3 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0014000499358 DQ6 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0074000516447 YJ5 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0036000396847 KM1 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0025000371883 GS1 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0060000521778 TM1 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0013000501872 DQ5 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0041000483088 KM6 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0044000444795 KM9 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0043000412825 KM8 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0054000457010 LJ9 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0056000652347 LUPWRUS00001 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0061000515270 TM2 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0070000535182 YJ1 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0004000421046 Basenji K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0038000404870 KM3 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0049000521041 LJ4 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0017000523362 DQ9 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0037000412203 KM2 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0009000506022 DQ1 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0035000478182 KM10 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0018000418890 FAMBBEM00001 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0002000332928 CID1 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-08-02 2014-08-02
snp_cf0042000497515 KM7 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0046000454772 LJ1 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0071000519745 YJ2 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0032000383168 GS8 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0051000506224 LJ6 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0057000631340 LUPWRUS00002 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0040000440856 KM5 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0055000647301 LUPWCHN00001 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0007000423999 Dingo K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0065000483008 TM6 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0073000514679 YJ4 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0076000524253 YJ7 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0039000402416 KM4 G CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
snp_cf0015000506985 DQ7 K CATCCTCAGATTCTGGCTTCTCAGTCTGTT ACTCCCCCTGCAAACCAGTCCAAAGGATTA 2014-07-19 2014-07-19
6.Fasta Information
TCGCTCGGTC CGCTCCCACT CATCCTCAGA TTCTGGCTTC TCAGTCTGTT
G
ACTCCCCCTG CAAACCAGTC CAAAGGATTA CATAAGGTCT CCTAGGAAGC