e.g. 1:1246..9423
SNP Detail For snp_cf0028000383920    [See in GBrowse]
1.General Information
SNP ID: snp_cf0028000383920
Organism: Canis familiaris
Individual: GS4
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22225467  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GCACTTATTGTAGAAGACCTTAGCATCTTA
3'flank: CCTGACTTCCCTGAACCTTGGGGGAGAACA
3.Reference Map information
Chrom Position Reference GS4
Chr12 499934 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000442 7506 - C CDS
ENSCAFG00000000442 7506 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000700 4538 GGT => GAT ENSCAFP00000000644 1513 G => D
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0076000524315 YJ7 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0024000419636 GS10 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0072000524940 YJ3 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0027000386940 GS3 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0011000511786 DQ3 T GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0025000371922 GS1 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0029000337667 GS5 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0030000395572 GS6 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0060000521818 TM1 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0070000535249 YJ1 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0031000390354 GS7 T GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0078000522410 YJ9 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0021000482661 FAMICHN00001 T GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0033000406285 GS9 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0041000483133 KM6 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0002000332961 CID1 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-08-02 2014-08-02
snp_cf0045000438919 LJ10 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0010000505184 DQ2 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0042000497572 KM7 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0016000509625 DQ8 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0007000424052 Dingo Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0066000515980 TM7 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0054000457061 LJ9 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0003000276108 dbSNP139 T GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0018000418929 FAMBBEM00001 Y GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
snp_cf0050000457894 LJ5 T GCACTTATTGTAGAAGACCTTAGCATCTTA CCTGACTTCCCTGAACCTTGGGGGAGAACA 2014-07-19 2014-07-19
6.Fasta Information
GAGTGGTAAG AACTGGCACA GCACTTATTG TAGAAGACCT TAGCATCTTA
T
CCTGACTTCC CTGAACCTTG GGGGAGAACA GTTGATCTGT AGGGGTGACA