e.g. 1:1246..9423
SNP Detail For snp_cf0028000383924    [See in GBrowse]
1.General Information
SNP ID: snp_cf0028000383924
Organism: Canis familiaris
Individual: GS4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: TGGATCTCACTTTCCTCCACATCTGTATCA
3'flank: TACCAGCTGGGATCTCCTGTAGATGTACCA
3.Reference Map information
Chrom Position Reference GS4
Chr12 505370 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000442 2070 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000700 1121 AAT => AGT ENSCAFP00000000644 374 N => S
- ENSCAFT00000000703 371 AAT => AGT ENSCAFP00000000647 124 N => S
- ENSCAFT00000043014 1097 AAT => AGT ENSCAFP00000038554 366 N => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0042000497580 KM7 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0016000509630 DQ8 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0010000505191 DQ2 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0031000390359 GS7 C TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0072000524948 YJ3 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0076000524319 YJ7 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0027000386948 GS3 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0045000438925 LJ10 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0021000482666 FAMICHN00001 C TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0025000371929 GS1 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0011000511791 DQ3 C TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0066000515987 TM7 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0058000642382 LUPWRUS00003 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0078000522414 YJ9 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0030000395576 GS6 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0024000419643 GS10 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0029000337671 GS5 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0018000418933 FAMBBEM00001 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0060000521824 TM1 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0007000424056 Dingo Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0050000457899 LJ5 C TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0033000406292 GS9 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0070000535256 YJ1 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
snp_cf0054000457065 LJ9 Y TGGATCTCACTTTCCTCCACATCTGTATCA TACCAGCTGGGATCTCCTGTAGATGTACCA 2014-07-19 2014-07-19
6.Fasta Information
TCTCCAGAGG GACTGCCAGT TGGATCTCAC TTTCCTCCAC ATCTGTATCA
C
TACCAGCTGG GATCTCCTGT AGATGTACCA AAGCAGGTTC CTGAAGACTC