e.g. 1:1246..9423
SNP Detail For snp_cf0028000384249    [See in GBrowse]
1.General Information
SNP ID: snp_cf0028000384249
Organism: Canis familiaris
Individual: GS4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC
3'flank: GGTCCCACCCTCTCTCTACCCAGTCAGAGC
3.Reference Map information
Chrom Position Reference GS4
Chr12 682126 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000454 94 + A CDS
ENSCAFG00000000470 130626 + A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000742 94 AGG => GGG ENSCAFP00000000685 32 R => G
+ ENSCAFT00000037049 70 AGG => GGG ENSCAFP00000032497 24 R => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0007000424345 Dingo R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0016000510100 DQ8 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0072000525438 YJ3 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0013000502441 DQ5 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0052000493694 LJ7 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0057000631822 LUPWRUS00002 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0031000390758 GS7 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0020000500923 FAMBTIM00001 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0018000419251 FAMBBEM00001 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0055000647775 LUPWCHN00001 G TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0034000618010 ISW G TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0015000507547 DQ7 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0033000406707 GS9 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0004000421584 Basenji R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0076000524668 YJ7 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0014000499766 DQ6 G TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0024000420056 GS10 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0025000372343 GS1 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0029000338000 GS5 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0078000522771 YJ9 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0005000627557 CHW G TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0030000395909 GS6 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0001000251307 solidGW1 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-08-01 2014-08-01
snp_cf0010000505656 DQ2 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0044000445183 KM9 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0064000515440 TM5 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
snp_cf0009000506548 DQ1 R TGGGGGCTCGGGCCCTCTCAGGCCCTCCGC GGTCCCACCCTCTCTCTACCCAGTCAGAGC 2014-07-19 2014-07-19
6.Fasta Information
CCTCGCTTCC ATCACGGTGC TGGGGGCTCG GGCCCTCTCA GGCCCTCCGC
G
GGTCCCACCC TCTCTCTACC CAGTCAGAGC CGTGCCGGTC CTCCCTCTCC