e.g. 1:1246..9423
SNP Detail For snp_cf0028000384311    [See in GBrowse]
1.General Information
SNP ID: snp_cf0028000384311
Organism: Canis familiaris
Individual: GS4
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CAAGCAGCTGTCCAACTCCAACATGGCCCA
3'flank: GCAGCCCTCTGCATCCGCTCCACCTTCGGC
3.Reference Map information
Chrom Position Reference GS4
Chr12 705387 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000470 153887 + G intron
ENSCAFG00000000470 153887 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000746 9 CAG => CAC ENSCAFP00000000689 3 Q => H
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0054000457520 LJ9 C CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0007000424422 Dingo S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0048000482956 LJ3 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0029000338078 GS5 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0073000515260 YJ4 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0064000515517 TM5 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0035000478692 KM10 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0024000420135 GS10 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0025000372422 GS1 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0075000529075 YJ6 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0031000390843 GS7 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0076000524748 YJ7 C CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0016000510182 DQ8 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0049000521541 LJ4 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0070000535737 YJ1 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0044000445271 KM9 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0033000406787 GS9 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0078000522852 YJ9 C CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0030000395987 GS6 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
snp_cf0043000413216 KM8 S CAAGCAGCTGTCCAACTCCAACATGGCCCA GCAGCCCTCTGCATCCGCTCCACCTTCGGC 2014-07-19 2014-07-19
6.Fasta Information
GGGACCCCAG CCCATGGTCC CAAGCAGCTG TCCAACTCCA ACATGGCCCA
C
GCAGCCCTCT GCATCCGCTC CACCTTCGGC CTCCAGTGCT ACCTCCTCTT