e.g. 1:1246..9423
SNP Detail For snp_cf0029001231043    [See in GBrowse]
1.General Information
SNP ID: snp_cf0029001231043
Organism: Canis familiaris
Individual: GS5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: ATTTGCACAACAGGTGCCGGCTCTCCTGGC
3'flank: GCCGACTGGGAGGGGAGATGCGGTAGCAGC
3.Reference Map information
Chrom Position Reference GS5
Chr20 2474821 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000004143 6171 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044496 1023 GCT => GCC ENSCAFP00000039075 341 A => A
- ENSCAFT00000006644 1023 GCT => GCC ENSCAFP00000006152 341 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0075001749908 YJ6 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0007001471049 Dingo G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0024001361416 GS10 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0049001723856 LJ4 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0058002142185 LUPWRUS00003 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0026001314375 GS2 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0066001744416 TM7 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0064001719877 TM5 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0036001342973 KM1 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0038001352450 KM3 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0023001603613 FAMICHN00003 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0063001683650 TM4 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0006001978187 CRW G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0033001344553 GS9 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0034002014263 ISW G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0068001667047 TM9 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0019001306628 FAMBGSD00001 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0011001734840 DQ3 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0022001530054 FAMICHN00002 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0042001787301 KM7 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0041001725846 KM6 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0052001668207 LJ7 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0076001762603 YJ7 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0025001332534 GS1 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0035001658338 KM10 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0059001702321 TM10 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0065001691214 TM6 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0010001687182 DQ2 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0069001767333 YJ10 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0070001808702 YJ1 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0009001710637 DQ1 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0073001704158 YJ4 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0016001713350 DQ8 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0071001744021 YJ2 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0074001726559 YJ5 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0012001694460 DQ4 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0021001627340 FAMICHN00001 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0027001340377 GS3 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0037001445408 KM2 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0039001411620 KM4 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0060001680727 TM1 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0032001311833 GS8 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0013001630046 DQ5 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0044001508915 KM9 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0077001735550 YJ8 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0028001276216 GS4 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0078001747632 YJ9 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0051001700211 LJ6 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0062001714126 TM3 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0015001707455 DQ7 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0008001706352 DQ10 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0055002136691 LUPWCHN00001 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0040001517551 KM5 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0031001337092 GS7 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0056002164176 LUPWRUS00001 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0018001439166 FAMBBEM00001 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0067001679415 TM8 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0005002032684 CHW G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0004001436157 Basenji G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0057002054770 LUPWRUS00002 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0053001659450 LJ8 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0061001734751 TM2 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0043001436816 KM8 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0072001755991 YJ3 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0017001728869 DQ9 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0030001326398 GS6 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0014001680083 DQ6 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
snp_cf0020001696214 FAMBTIM00001 G ATTTGCACAACAGGTGCCGGCTCTCCTGGC GCCGACTGGGAGGGGAGATGCGGTAGCAGC 2014-07-19 2014-07-19
6.Fasta Information
GTGGTGGTTG TCGTCTGACA ATTTGCACAA CAGGTGCCGG CTCTCCTGGC
G
GCCGACTGGG AGGGGAGATG CGGTAGCAGC AGGCTGGGCT CCCACGCCCC