e.g. 1:1246..9423
SNP Detail For snp_cf0029001231592    [See in GBrowse]
1.General Information
SNP ID: snp_cf0029001231592
Organism: Canis familiaris
Individual: GS5
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22916050  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GCCGCGGTCCGAGCGGTCACTGAGGTCCAC
3'flank: GAGCTGTCGCTGGGCGGCTCAATGGTGAGC
3.Reference Map information
Chrom Position Reference GS5
Chr20 3275002 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000004358 5376 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000043342 801 TCT => TCC ENSCAFP00000037376 267 S => S
- ENSCAFT00000006990 1128 TCT => TCC ENSCAFP00000006470 376 S => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0026001315006 GS2 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0011001735123 DQ3 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0052001668836 LJ7 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0071001744782 YJ2 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0025001332944 GS1 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0034002015262 ISW G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0067001679724 TM8 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0027001340794 GS3 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0028001276760 GS4 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0006001979511 CRW G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0044001509428 KM9 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0069001767981 YJ10 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0063001684381 TM4 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0033001345347 GS9 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0008001706649 DQ10 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0013001630608 DQ5 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0024001362225 GS10 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0040001518348 KM5 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0042001788017 KM7 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0001000763789 solidGW1 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-08-01 2014-08-01
snp_cf0003000958289 dbSNP139 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0015001708049 DQ7 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0038001352717 KM3 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0018001439406 FAMBBEM00001 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0066001744706 TM7 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0032001312260 GS8 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0076001763357 YJ7 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0005002033676 CHW R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0056002165440 LUPWRUS00001 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0039001412246 KM4 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0055002137937 LUPWCHN00001 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0030001326813 GS6 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0064001720505 TM5 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0041001726567 KM6 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0074001727189 YJ5 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0065001691852 TM6 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0031001337505 GS7 G GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0057002055346 LUPWRUS00002 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
snp_cf0019001307247 FAMBGSD00001 R GCCGCGGTCCGAGCGGTCACTGAGGTCCAC GAGCTGTCGCTGGGCGGCTCAATGGTGAGC 2014-07-19 2014-07-19
6.Fasta Information
GCGCCCTGCC TCTTGAGCGA GCCGCGGTCC GAGCGGTCAC TGAGGTCCAC
R
GAGCTGTCGC TGGGCGGCTC AATGGTGAGC AGCGGGAGGT GCTCCACCCG