e.g. 1:1246..9423
SNP Detail For snp_cf0029001232333    [See in GBrowse]
1.General Information
SNP ID: snp_cf0029001232333
Organism: Canis familiaris
Individual: GS5
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22850423  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CGTCAGGCCGACACTGATGGTGCGCACGAC
3'flank: CACGTGTTGTTGGTGCTGCCCTTCCCAATC
3.Reference Map information
Chrom Position Reference GS5
Chr20 3648500 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000004375 92175 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000050198 3747 TGT => TGC ENSCAFP00000041391 1249 C => C
- ENSCAFT00000007053 4203 TGT => TGC ENSCAFP00000006530 1401 C => C
- ENSCAFT00000048997 4335 TGT => TGC ENSCAFP00000036016 1445 C => C
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0028001277290 GS4 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0014001681990 DQ6 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0007001472377 Dingo G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0066001745108 TM7 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0076001764038 YJ7 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0005002034452 CHW G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0036001344599 KM1 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0006001980137 CRW G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0038001353061 KM3 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0041001727546 KM6 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0055002138571 LUPWCHN00001 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0042001789044 KM7 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0023001605179 FAMICHN00003 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0047001657769 LJ2 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0057002056059 LUPWRUS00002 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0045001539851 LJ10 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0075001751438 YJ6 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0026001315748 GS2 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0072001757634 YJ3 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0064001721413 TM5 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0010001688553 DQ2 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0001000764383 solidGW1 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-08-01 2014-08-01
snp_cf0020001697719 FAMBTIM00001 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0018001439753 FAMBBEM00001 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0056002166300 LUPWRUS00001 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0052001669544 LJ7 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0061001736265 TM2 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0037001447153 KM2 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0034002015772 ISW G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0019001307979 FAMBGSD00001 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0063001685098 TM4 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0049001725428 LJ4 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0073001705834 YJ4 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0008001707574 DQ10 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0071001745543 YJ2 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0062001715352 TM3 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0043001438560 KM8 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0035001659891 KM10 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0070001810632 YJ1 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0012001695866 DQ4 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0032001312939 GS8 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0015001708823 DQ7 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0058002143865 LUPWRUS00003 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0039001413017 KM4 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0051001701706 LJ6 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0059001704008 TM10 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0004001437758 Basenji G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0078001749164 YJ9 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0033001346245 GS9 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0068001668461 TM9 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0003000958999 dbSNP139 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0024001363104 GS10 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0067001680449 TM8 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0040001519249 KM5 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0044001510267 KM9 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0065001692722 TM6 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0011001735863 DQ3 R CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0009001712038 DQ1 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
snp_cf0046001583913 LJ1 G CGTCAGGCCGACACTGATGGTGCGCACGAC CACGTGTTGTTGGTGCTGCCCTTCCCAATC 2014-07-19 2014-07-19
6.Fasta Information
GTGTCCCACA CACTGAGCAG CGTCAGGCCG ACACTGATGG TGCGCACGAC
G
CACGTGTTGT TGGTGCTGCC CTTCCCAATC TGCACAAACT CGTCTCTAGG